Incidental Mutation 'R3844:Sri'
ID277271
Institutional Source Beutler Lab
Gene Symbol Sri
Ensembl Gene ENSMUSG00000003161
Gene Namesorcin
SynonymsSor, 2210417O06Rik, 2900070H08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R3844 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8046078-8069379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8064576 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 177 (D177G)
Ref Sequence ENSEMBL: ENSMUSP00000118221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088786] [ENSMUST00000148633]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000003245
Predicted Effect probably damaging
Transcript: ENSMUST00000088786
AA Change: D162G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086165
Gene: ENSMUSG00000003161
AA Change: D162G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EF-hand_5 30 43 8.7e-4 PFAM
EFh 59 87 6.75e0 SMART
EFh 89 117 1.02e-2 SMART
Blast:EFh 153 183 9e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144265
Predicted Effect probably damaging
Transcript: ENSMUST00000148633
AA Change: D177G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118221
Gene: ENSMUSG00000003161
AA Change: D177G

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:EF-hand_5 45 58 9.6e-4 PFAM
EFh 74 102 6.75e0 SMART
EFh 104 132 1.02e-2 SMART
Blast:EFh 168 198 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197065
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,200,032 R2* probably null Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam5 T A 8: 24,813,410 D167V probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Aqp11 T A 7: 97,737,839 E50V probably damaging Het
Arid4b C T 13: 14,187,060 S703L probably damaging Het
Ccl25 T G 8: 4,354,183 V179G possibly damaging Het
Clk2 A G 3: 89,170,403 N222S probably benign Het
Col13a1 C T 10: 61,850,209 G668D unknown Het
Col20a1 A G 2: 180,992,449 E69G probably damaging Het
Dcc G A 18: 71,826,186 H172Y probably benign Het
Dock8 T G 19: 25,065,430 Y125* probably null Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Fars2 T C 13: 36,205,101 F191S probably damaging Het
Filip1l T C 16: 57,572,427 V888A probably benign Het
Fn1 T A 1: 71,609,574 H1392L possibly damaging Het
Fsip2 C T 2: 82,989,606 H5228Y possibly damaging Het
Galnt14 A G 17: 73,709,929 probably null Het
Grm8 A T 6: 27,429,508 N462K possibly damaging Het
Ireb2 A G 9: 54,892,505 E410G probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kdm7a T A 6: 39,181,579 I77F probably damaging Het
Klhl11 A T 11: 100,472,307 M141K possibly damaging Het
Lactbl1 A G 4: 136,637,960 H541R possibly damaging Het
Mylk A G 16: 34,921,877 M920V probably benign Het
Olfr1369-ps1 A G 13: 21,116,063 T124A possibly damaging Het
Piwil4 T A 9: 14,729,960 T179S possibly damaging Het
Ranbp2 T C 10: 58,477,895 L1479P possibly damaging Het
Rpl3l A G 17: 24,733,942 H292R probably benign Het
Rps6ka4 C A 19: 6,837,803 E202* probably null Het
Rsph14 T C 10: 75,031,275 D13G possibly damaging Het
Tenm2 A G 11: 36,047,538 V1437A probably damaging Het
Tiam2 A G 17: 3,421,651 R523G probably damaging Het
Tm9sf3 A T 19: 41,217,116 L561M possibly damaging Het
Tnrc6c G T 11: 117,755,483 D1417Y probably damaging Het
Ubr4 C T 4: 139,459,126 S648L probably damaging Het
Zfp827 T A 8: 79,136,619 L69Q probably damaging Het
Other mutations in Sri
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Sri APN 5 8063755 splice site probably null
IGL02442:Sri APN 5 8062411 missense probably damaging 1.00
IGL02661:Sri APN 5 8063252 splice site probably benign
IGL02675:Sri APN 5 8067534 missense probably damaging 1.00
R0847:Sri UTSW 5 8063755 splice site probably null
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0974:Sri UTSW 5 8059381 missense probably damaging 1.00
R1187:Sri UTSW 5 8059416 missense probably damaging 1.00
R2860:Sri UTSW 5 8067540 missense probably benign 0.26
R2861:Sri UTSW 5 8067540 missense probably benign 0.26
R4345:Sri UTSW 5 8059427 splice site probably null
R4575:Sri UTSW 5 8063693 missense probably damaging 1.00
R4704:Sri UTSW 5 8062430 splice site probably null
R5878:Sri UTSW 5 8059353 missense probably damaging 1.00
R6257:Sri UTSW 5 8059596 splice site probably null
R6944:Sri UTSW 5 8063365 missense probably benign 0.09
R7716:Sri UTSW 5 8056641 critical splice donor site probably null
R7917:Sri UTSW 5 8063409 critical splice donor site probably null
R7929:Sri UTSW 5 8057652 intron probably benign
R7960:Sri UTSW 5 8064586 missense probably benign 0.04
R8316:Sri UTSW 5 8063317 missense probably damaging 0.96
X0061:Sri UTSW 5 8063368 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGACCATTGACCACTTTCGG -3'
(R):5'- CATGAGCCACCATGTCCTATTATG -3'

Sequencing Primer
(F):5'- TCGGTCACTGTTACATATTGACTAG -3'
(R):5'- GCTTGAATTCATGGCAAGCC -3'
Posted On2015-04-06