Mutagenetix > Incidental Mutations

Incidental Mutation 'R3844:Piwil4'

277279

Institutional Source

Beutler Lab

Gene Symbol

Piwil4

Ensembl Gene

ENSMUSG00000036912

Gene Name

piwi-like RNA-mediated gene silencing 4

Synonyms

Miwi2, 9230101H05Rik, MIWI2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R3844 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14696230-14740733 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14729960 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 179 (T179S)

Ref Sequence

ENSEMBL: ENSMUSP00000111308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]

Predicted Effect

probably benign
Transcript: ENSMUST00000076946
AA Change: T242S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: T242S

Domain	Start	End	E-Value	Type
Pfam:ArgoN	155	300	3.7e-11	PFAM
PAZ	313	450	2.55e-67	SMART
Piwi	614	864	8.98e-95	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115644
AA Change: T179S

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: T179S

Domain	Start	End	E-Value	Type
Pfam:ArgoN	92	245	6.5e-10	PFAM
PAZ	266	403	2.55e-67	SMART
Piwi	541	834	6.71e-126	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730071L15Rik	A	T	11: 6,200,032	R2*	probably null	Het
Acaca	T	A	11: 84,364,413	D1932E	probably damaging	Het
Adam5	T	A	8: 24,813,410	D167V	probably benign	Het
Amt	C	T	9: 108,297,221	R62C	possibly damaging	Het
Aqp11	T	A	7: 97,737,839	E50V	probably damaging	Het
Arid4b	C	T	13: 14,187,060	S703L	probably damaging	Het
Ccl25	T	G	8: 4,354,183	V179G	possibly damaging	Het
Clk2	A	G	3: 89,170,403	N222S	probably benign	Het
Col13a1	C	T	10: 61,850,209	G668D	unknown	Het
Col20a1	A	G	2: 180,992,449	E69G	probably damaging	Het
Dcc	G	A	18: 71,826,186	H172Y	probably benign	Het
Dock8	T	G	19: 25,065,430	Y125*	probably null	Het
E2f1	A	G	2: 154,560,828	S340P	probably benign	Het
Fars2	T	C	13: 36,205,101	F191S	probably damaging	Het
Filip1l	T	C	16: 57,572,427	V888A	probably benign	Het
Fn1	T	A	1: 71,609,574	H1392L	possibly damaging	Het
Fsip2	C	T	2: 82,989,606	H5228Y	possibly damaging	Het
Galnt14	A	G	17: 73,709,929		probably null	Het
Grm8	A	T	6: 27,429,508	N462K	possibly damaging	Het
Ireb2	A	G	9: 54,892,505	E410G	probably damaging	Het
Kdm2b	A	T	5: 122,934,793	Y341N	probably damaging	Het
Kdm7a	T	A	6: 39,181,579	I77F	probably damaging	Het
Klhl11	A	T	11: 100,472,307	M141K	possibly damaging	Het
Lactbl1	A	G	4: 136,637,960	H541R	possibly damaging	Het
Mylk	A	G	16: 34,921,877	M920V	probably benign	Het
Olfr1369-ps1	A	G	13: 21,116,063	T124A	possibly damaging	Het
Ranbp2	T	C	10: 58,477,895	L1479P	possibly damaging	Het
Rpl3l	A	G	17: 24,733,942	H292R	probably benign	Het
Rps6ka4	C	A	19: 6,837,803	E202*	probably null	Het
Rsph14	T	C	10: 75,031,275	D13G	possibly damaging	Het
Sri	A	G	5: 8,064,576	D177G	probably damaging	Het
Tenm2	A	G	11: 36,047,538	V1437A	probably damaging	Het
Tiam2	A	G	17: 3,421,651	R523G	probably damaging	Het
Tm9sf3	A	T	19: 41,217,116	L561M	possibly damaging	Het
Tnrc6c	G	T	11: 117,755,483	D1417Y	probably damaging	Het
Ubr4	C	T	4: 139,459,126	S648L	probably damaging	Het
Zfp827	T	A	8: 79,136,619	L69Q	probably damaging	Het

Other mutations in Piwil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Piwil4	APN	9	14703097	missense	probably damaging	1.00
IGL00331:Piwil4	APN	9	14715031	splice site	probably benign
IGL00848:Piwil4	APN	9	14727411	missense	probably damaging	0.98
IGL00920:Piwil4	APN	9	14727437	missense	probably damaging	1.00
IGL01583:Piwil4	APN	9	14734487	missense	probably damaging	1.00
IGL01690:Piwil4	APN	9	14703095	missense	probably damaging	1.00
IGL01763:Piwil4	APN	9	14706266	splice site	probably null
IGL02103:Piwil4	APN	9	14725986	splice site	probably null
IGL02898:Piwil4	APN	9	14706287	unclassified	probably benign
IGL03037:Piwil4	APN	9	14705012	missense	possibly damaging	0.88
IGL03352:Piwil4	APN	9	14725887	missense	probably damaging	1.00
PIT4651001:Piwil4	UTSW	9	14708899	missense	possibly damaging	0.48
R0453:Piwil4	UTSW	9	14727452	missense	probably benign	0.00
R2324:Piwil4	UTSW	9	14736908	missense	possibly damaging	0.88
R3236:Piwil4	UTSW	9	14700248	unclassified	probably benign
R3408:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R3689:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R4191:Piwil4	UTSW	9	14715000	missense	probably damaging	0.99
R4505:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R4506:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R4541:Piwil4	UTSW	9	14718316	missense	probably damaging	1.00
R4652:Piwil4	UTSW	9	14712308	nonsense	probably null
R4876:Piwil4	UTSW	9	14740465	missense	probably benign	0.22
R5027:Piwil4	UTSW	9	14709944	missense	probably damaging	1.00
R5479:Piwil4	UTSW	9	14705041	missense	probably damaging	1.00
R6656:Piwil4	UTSW	9	14709934	missense	probably damaging	1.00
R6736:Piwil4	UTSW	9	14715823	missense	probably benign
R7096:Piwil4	UTSW	9	14736816	nonsense	probably null
R7124:Piwil4	UTSW	9	14736900	missense	probably benign
R7358:Piwil4	UTSW	9	14729993	missense	possibly damaging	0.82
R7371:Piwil4	UTSW	9	14727433	missense	probably benign	0.08
R7419:Piwil4	UTSW	9	14702395	missense	probably damaging	1.00
R7467:Piwil4	UTSW	9	14705041	missense	probably damaging	1.00
R7571:Piwil4	UTSW	9	14734597	missense	probably benign	0.08
R7644:Piwil4	UTSW	9	14734415	splice site	probably null
R7992:Piwil4	UTSW	9	14703149	missense
R8284:Piwil4	UTSW	9	14727478	missense	probably benign	0.00
X0026:Piwil4	UTSW	9	14740591	utr 5 prime	probably benign
X0064:Piwil4	UTSW	9	14708875	missense	probably benign	0.00
Z1088:Piwil4	UTSW	9	14734517	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCTGGGGTAAGGCTAGTTAC -3'
(R):5'- CCATAATTTGATCCCCAGATGTG -3'

Sequencing Primer
(F):5'- ACTGAGATAGATGGTGTCCCGTC -3'
(R):5'- GGATTGGATTATTGCACATGCTAAC -3'

Posted On

2015-04-06