Mutagenetix > Incidental Mutation

Incidental Mutation 'R3844:Filip1l'

277295

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3844 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57572427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 888 (V888A)

Ref Sequence

ENSEMBL: ENSMUSP00000124069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159414
AA Change: V888A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: V888A

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159816
AA Change: V1126A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: V1126A

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730071L15Rik	A	T	11: 6,200,032	R2*	probably null	Het
Acaca	T	A	11: 84,364,413	D1932E	probably damaging	Het
Adam5	T	A	8: 24,813,410	D167V	probably benign	Het
Amt	C	T	9: 108,297,221	R62C	possibly damaging	Het
Aqp11	T	A	7: 97,737,839	E50V	probably damaging	Het
Arid4b	C	T	13: 14,187,060	S703L	probably damaging	Het
Ccl25	T	G	8: 4,354,183	V179G	possibly damaging	Het
Clk2	A	G	3: 89,170,403	N222S	probably benign	Het
Col13a1	C	T	10: 61,850,209	G668D	unknown	Het
Col20a1	A	G	2: 180,992,449	E69G	probably damaging	Het
Dcc	G	A	18: 71,826,186	H172Y	probably benign	Het
Dock8	T	G	19: 25,065,430	Y125*	probably null	Het
E2f1	A	G	2: 154,560,828	S340P	probably benign	Het
Fars2	T	C	13: 36,205,101	F191S	probably damaging	Het
Fn1	T	A	1: 71,609,574	H1392L	possibly damaging	Het
Fsip2	C	T	2: 82,989,606	H5228Y	possibly damaging	Het
Galnt14	A	G	17: 73,709,929		probably null	Het
Grm8	A	T	6: 27,429,508	N462K	possibly damaging	Het
Ireb2	A	G	9: 54,892,505	E410G	probably damaging	Het
Kdm2b	A	T	5: 122,934,793	Y341N	probably damaging	Het
Kdm7a	T	A	6: 39,181,579	I77F	probably damaging	Het
Klhl11	A	T	11: 100,472,307	M141K	possibly damaging	Het
Lactbl1	A	G	4: 136,637,960	H541R	possibly damaging	Het
Mylk	A	G	16: 34,921,877	M920V	probably benign	Het
Olfr1369-ps1	A	G	13: 21,116,063	T124A	possibly damaging	Het
Piwil4	T	A	9: 14,729,960	T179S	possibly damaging	Het
Ranbp2	T	C	10: 58,477,895	L1479P	possibly damaging	Het
Rpl3l	A	G	17: 24,733,942	H292R	probably benign	Het
Rps6ka4	C	A	19: 6,837,803	E202*	probably null	Het
Rsph14	T	C	10: 75,031,275	D13G	possibly damaging	Het
Sri	A	G	5: 8,064,576	D177G	probably damaging	Het
Tenm2	A	G	11: 36,047,538	V1437A	probably damaging	Het
Tiam2	A	G	17: 3,421,651	R523G	probably damaging	Het
Tm9sf3	A	T	19: 41,217,116	L561M	possibly damaging	Het
Tnrc6c	G	T	11: 117,755,483	D1417Y	probably damaging	Het
Ubr4	C	T	4: 139,459,126	S648L	probably damaging	Het
Zfp827	T	A	8: 79,136,619	L69Q	probably damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R8742:Filip1l	UTSW	16	57571230	missense	probably damaging	1.00
R9020:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTCAAGTGTGATAACTACTGAG -3'
(R):5'- GCAGGCAACACATAGTTAGTTCC -3'

Sequencing Primer
(F):5'- GAAGTCCTTACATGCAAGCTGTG -3'
(R):5'- GGCAACACATAGTTAGTTCCAGATAC -3'

Posted On

2015-04-06