Incidental Mutation 'R3844:Tiam2'
ID 277296
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene Name T cell lymphoma invasion and metastasis 2
Synonyms 3000002F19Rik, STEF
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3844 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 3326573-3531344 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3421651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 523 (R523G)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]
AlphaFold Q6ZPF3
Predicted Effect probably damaging
Transcript: ENSMUST00000072156
AA Change: R523G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: R523G

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169838
AA Change: R523G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: R523G

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226905
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,200,032 R2* probably null Het
Acaca T A 11: 84,364,413 D1932E probably damaging Het
Adam5 T A 8: 24,813,410 D167V probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Aqp11 T A 7: 97,737,839 E50V probably damaging Het
Arid4b C T 13: 14,187,060 S703L probably damaging Het
Ccl25 T G 8: 4,354,183 V179G possibly damaging Het
Clk2 A G 3: 89,170,403 N222S probably benign Het
Col13a1 C T 10: 61,850,209 G668D unknown Het
Col20a1 A G 2: 180,992,449 E69G probably damaging Het
Dcc G A 18: 71,826,186 H172Y probably benign Het
Dock8 T G 19: 25,065,430 Y125* probably null Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Fars2 T C 13: 36,205,101 F191S probably damaging Het
Filip1l T C 16: 57,572,427 V888A probably benign Het
Fn1 T A 1: 71,609,574 H1392L possibly damaging Het
Fsip2 C T 2: 82,989,606 H5228Y possibly damaging Het
Galnt14 A G 17: 73,709,929 probably null Het
Grm8 A T 6: 27,429,508 N462K possibly damaging Het
Ireb2 A G 9: 54,892,505 E410G probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kdm7a T A 6: 39,181,579 I77F probably damaging Het
Klhl11 A T 11: 100,472,307 M141K possibly damaging Het
Lactbl1 A G 4: 136,637,960 H541R possibly damaging Het
Mylk A G 16: 34,921,877 M920V probably benign Het
Olfr1369-ps1 A G 13: 21,116,063 T124A possibly damaging Het
Piwil4 T A 9: 14,729,960 T179S possibly damaging Het
Ranbp2 T C 10: 58,477,895 L1479P possibly damaging Het
Rpl3l A G 17: 24,733,942 H292R probably benign Het
Rps6ka4 C A 19: 6,837,803 E202* probably null Het
Rsph14 T C 10: 75,031,275 D13G possibly damaging Het
Sri A G 5: 8,064,576 D177G probably damaging Het
Tenm2 A G 11: 36,047,538 V1437A probably damaging Het
Tm9sf3 A T 19: 41,217,116 L561M possibly damaging Het
Tnrc6c G T 11: 117,755,483 D1417Y probably damaging Het
Ubr4 C T 4: 139,459,126 S648L probably damaging Het
Zfp827 T A 8: 79,136,619 L69Q probably damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3518585 missense probably damaging 0.99
R8260:Tiam2 UTSW 17 3518319 missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3518262 missense probably benign 0.05
R8530:Tiam2 UTSW 17 3450812 missense probably benign 0.03
R8692:Tiam2 UTSW 17 3428807 missense probably damaging 1.00
R8902:Tiam2 UTSW 17 3477196 missense probably benign 0.00
R9067:Tiam2 UTSW 17 3511132 missense probably damaging 1.00
R9080:Tiam2 UTSW 17 3414244 missense probably benign
R9090:Tiam2 UTSW 17 3414736 missense probably damaging 1.00
R9211:Tiam2 UTSW 17 3448454 missense possibly damaging 0.94
R9271:Tiam2 UTSW 17 3414736 missense probably damaging 1.00
R9347:Tiam2 UTSW 17 3421648 missense probably benign 0.37
R9353:Tiam2 UTSW 17 3507799 nonsense probably null
R9407:Tiam2 UTSW 17 3503023 missense probably damaging 1.00
R9460:Tiam2 UTSW 17 3437310 missense probably damaging 1.00
R9550:Tiam2 UTSW 17 3509431 missense probably damaging 1.00
R9748:Tiam2 UTSW 17 3511165 missense probably benign 0.20
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAATCCACTCACGCTATCAG -3'
(R):5'- TGTACACACATGCTTAGACACGC -3'

Sequencing Primer
(F):5'- CCGACAGAACATCTATGAGAATTTC -3'
(R):5'- GCAATATTTACTCGACCATGCTGAC -3'
Posted On 2015-04-06