Mutagenetix > Incidental Mutation

Incidental Mutation 'R3845:Rev1'

277304

Institutional Source

Beutler Lab

Gene Symbol

Rev1

Ensembl Gene

ENSMUSG00000026082

Gene Name

REV1, DNA directed polymerase

Synonyms

REV1, Rev1l, 1110027I23Rik

MMRRC Submission

040893-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.887) question?

Stock #

R3845 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38052786-38129801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38098988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 72 (M72K)

Ref Sequence

ENSEMBL: ENSMUSP00000027251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000192594] [ENSMUST00000193697]

AlphaFold

Q920Q2

PDB Structure

Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027251
AA Change: M72K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: M72K

Domain	Start	End	E-Value	Type
BRCT	46	121	3.99e-13	SMART
low complexity region	320	342	N/A	INTRINSIC
Pfam:IMS	420	620	1.9e-43	PFAM
Pfam:IMS_C	700	831	5.8e-20	PFAM
low complexity region	888	901	N/A	INTRINSIC
Pfam:DUF4414	938	1071	9.7e-11	PFAM
Pfam:REV1_C	1127	1248	1.2e-43	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192594
AA Change: M72K

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141379
Gene: ENSMUSG00000026082
AA Change: M72K

Domain	Start	End	E-Value	Type
BRCT	46	121	2.5e-15	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193697
AA Change: M72K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141560
Gene: ENSMUSG00000026082
AA Change: M72K

Domain	Start	End	E-Value	Type
Pfam:BRCT	45	97	2.1e-4	PFAM
Pfam:PTCB-BRCT	52	96	1.3e-5	PFAM

Meta Mutation Damage Score

0.5383

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apool	A	T	X: 112,364,458		probably benign	Het
Atp4a	A	G	7: 30,717,115	N439S	probably null	Het
AU041133	T	A	10: 82,151,318	H268Q	probably damaging	Het
Ccdc105	T	C	10: 78,748,698	N330S	probably benign	Het
Ccdc136	C	T	6: 29,417,177	R666W	probably benign	Het
Ccdc97	T	C	7: 25,715,028		probably benign	Het
Celf1	T	C	2: 91,009,238	V336A	possibly damaging	Het
Chd3	T	C	11: 69,346,759	N1870D	possibly damaging	Het
Col5a3	C	T	9: 20,808,377	D229N	unknown	Het
Cpn1	G	T	19: 43,974,084	P142Q	possibly damaging	Het
Cubn	T	C	2: 13,283,008	D3420G	probably damaging	Het
Cyp2u1	A	G	3: 131,293,486	F482S	possibly damaging	Het
Foxo1	T	A	3: 52,346,280	D621E	probably benign	Het
Gm13084	T	C	4: 143,811,975	E142G	probably damaging	Het
Gm5346	T	C	8: 43,626,632	N185S	probably benign	Het
Grid2	A	G	6: 64,345,842	M609V	possibly damaging	Het
Hsd17b3	A	T	13: 64,089,062	F23I	possibly damaging	Het
Kcnk10	A	G	12: 98,440,744	I217T	probably benign	Het
Mis18bp1	G	A	12: 65,149,142	S616L	possibly damaging	Het
Mtch1	A	T	17: 29,342,832	F133I	probably damaging	Het
Myh4	T	A	11: 67,259,105	V1830E	possibly damaging	Het
Nav3	T	C	10: 109,853,376	M347V	possibly damaging	Het
Nbea	A	G	3: 56,086,292		probably benign	Het
Nhej1	A	T	1: 74,968,883	D76E	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1024	A	C	2: 85,904,737	C106G	probably damaging	Het
Papd5	A	T	8: 88,250,664	I322F	possibly damaging	Het
Pias3	T	C	3: 96,702,210	V307A	probably benign	Het
Pltp	T	A	2: 164,854,288	M135L	probably benign	Het
Plxna2	A	G	1: 194,793,790	Y1106C	probably damaging	Het
Ptgir	G	A	7: 16,907,386	R201H	probably damaging	Het
Ptk7	A	T	17: 46,586,418	D329E	probably benign	Het
Pygl	T	C	12: 70,198,443	D411G	probably benign	Het
Sfrp1	T	C	8: 23,412,248	L155P	probably damaging	Het
Slc5a4a	A	G	10: 76,189,149	E620G	probably damaging	Het
Smarca2	A	G	19: 26,720,873	I1314V	probably benign	Het
Tas2r109	G	A	6: 132,980,803	L55F	probably damaging	Het
Tek	T	A	4: 94,804,872	C274S	probably damaging	Het
Tmem38b	T	A	4: 53,859,905	D228E	probably benign	Het
Topbp1	T	C	9: 103,309,923	V109A	possibly damaging	Het
Trbv5	A	G	6: 41,062,748	I96V	probably benign	Het
Trim16	T	G	11: 62,836,672		probably benign	Het
Upf3a	A	T	8: 13,798,238	T345S	probably benign	Het
Usp15	A	G	10: 123,119,135	S913P	probably damaging	Het
Vmn2r124	T	A	17: 18,073,691	V680D	possibly damaging	Het
Vmn2r91	G	A	17: 18,107,598	V485I	probably benign	Het
Zdbf2	A	T	1: 63,308,324	H1954L	possibly damaging	Het

Other mutations in Rev1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Rev1	APN	1	38098940	missense	probably damaging	1.00
IGL01065:Rev1	APN	1	38099009	missense	possibly damaging	0.89
IGL01393:Rev1	APN	1	38092063	missense	probably damaging	1.00
IGL03003:Rev1	APN	1	38088073	missense	possibly damaging	0.77
H8562:Rev1	UTSW	1	38056767	missense	probably damaging	0.96
PIT1430001:Rev1	UTSW	1	38056256	unclassified	probably benign
R0409:Rev1	UTSW	1	38074368	nonsense	probably null
R0606:Rev1	UTSW	1	38059123	missense	probably null	1.00
R1134:Rev1	UTSW	1	38057687	missense	probably benign	0.04
R1171:Rev1	UTSW	1	38088500	missense	possibly damaging	0.89
R1208:Rev1	UTSW	1	38059118	unclassified	probably benign
R1440:Rev1	UTSW	1	38088205	missense	probably damaging	1.00
R1485:Rev1	UTSW	1	38088572	missense	probably benign	0.00
R1627:Rev1	UTSW	1	38055490	missense	probably damaging	0.99
R3948:Rev1	UTSW	1	38074333	missense	possibly damaging	0.69
R4074:Rev1	UTSW	1	38054238	missense	possibly damaging	0.50
R4075:Rev1	UTSW	1	38054238	missense	possibly damaging	0.50
R4076:Rev1	UTSW	1	38054238	missense	possibly damaging	0.50
R4248:Rev1	UTSW	1	38107648	missense	possibly damaging	0.87
R4293:Rev1	UTSW	1	38108419	missense	possibly damaging	0.89
R4548:Rev1	UTSW	1	38059194	missense	possibly damaging	0.72
R4610:Rev1	UTSW	1	38053649	missense	probably damaging	1.00
R4654:Rev1	UTSW	1	38079256	intron	probably benign
R5032:Rev1	UTSW	1	38074489	intron	probably benign
R5286:Rev1	UTSW	1	38055326	nonsense	probably null
R5311:Rev1	UTSW	1	38079393	missense	probably benign	0.00
R5327:Rev1	UTSW	1	38108451	nonsense	probably null
R6363:Rev1	UTSW	1	38071489	missense	probably damaging	1.00
R7050:Rev1	UTSW	1	38054271	missense	probably damaging	1.00
R7072:Rev1	UTSW	1	38067545	nonsense	probably null
R7132:Rev1	UTSW	1	38071449	missense	possibly damaging	0.95
R7264:Rev1	UTSW	1	38085601	missense	probably damaging	1.00
R7298:Rev1	UTSW	1	38053104	missense	probably damaging	1.00
R7367:Rev1	UTSW	1	38074407	nonsense	probably null
R7395:Rev1	UTSW	1	38088065	missense	possibly damaging	0.69
R7829:Rev1	UTSW	1	38056445	missense	probably damaging	0.98
R8053:Rev1	UTSW	1	38063141	missense	possibly damaging	0.67
R8093:Rev1	UTSW	1	38075016	intron	probably benign
R8356:Rev1	UTSW	1	38059243	nonsense	probably null
R8456:Rev1	UTSW	1	38059243	nonsense	probably null
R8461:Rev1	UTSW	1	38083787	missense	possibly damaging	0.56
R8724:Rev1	UTSW	1	38088069	missense	probably damaging	1.00
R8757:Rev1	UTSW	1	38059272	missense	probably damaging	1.00
R8759:Rev1	UTSW	1	38059272	missense	probably damaging	1.00
R8945:Rev1	UTSW	1	38083743	missense	probably damaging	0.98
R9309:Rev1	UTSW	1	38054864	missense	probably damaging	1.00
R9433:Rev1	UTSW	1	38053092	missense	probably damaging	1.00
R9500:Rev1	UTSW	1	38063133	nonsense	probably null
X0017:Rev1	UTSW	1	38053661	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAGCAGACACATGCTATTTG -3'
(R):5'- TGTGTCAAGGCAGGATAGC -3'

Sequencing Primer
(F):5'- GACACATGCTATTTGAAAGTAAGGCC -3'
(R):5'- GTCAAGGCAGGATAGCTTTATCACTC -3'

Posted On

2015-04-06