Incidental Mutation 'R3845:Rev1'
ID 277304
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene Name REV1, DNA directed polymerase
Synonyms 1110027I23Rik, Rev1l, REV1
MMRRC Submission 040893-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.921) question?
Stock # R3845 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 38091867-38168882 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38138069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 72 (M72K)
Ref Sequence ENSEMBL: ENSMUSP00000027251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000192594] [ENSMUST00000193697]
AlphaFold Q920Q2
PDB Structure Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027251
AA Change: M72K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: M72K

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192594
AA Change: M72K

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141379
Gene: ENSMUSG00000026082
AA Change: M72K

DomainStartEndE-ValueType
BRCT 46 121 2.5e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193697
AA Change: M72K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141560
Gene: ENSMUSG00000026082
AA Change: M72K

DomainStartEndE-ValueType
Pfam:BRCT 45 97 2.1e-4 PFAM
Pfam:PTCB-BRCT 52 96 1.3e-5 PFAM
Meta Mutation Damage Score 0.5383 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T C 8: 44,079,669 (GRCm39) N185S probably benign Het
Apool A T X: 111,274,155 (GRCm39) probably benign Het
Atp4a A G 7: 30,416,540 (GRCm39) N439S probably null Het
AU041133 T A 10: 81,987,152 (GRCm39) H268Q probably damaging Het
Ccdc136 C T 6: 29,417,176 (GRCm39) R666W probably benign Het
Ccdc97 T C 7: 25,414,453 (GRCm39) probably benign Het
Celf1 T C 2: 90,839,583 (GRCm39) V336A possibly damaging Het
Chd3 T C 11: 69,237,585 (GRCm39) N1870D possibly damaging Het
Col5a3 C T 9: 20,719,673 (GRCm39) D229N unknown Het
Cpn1 G T 19: 43,962,523 (GRCm39) P142Q possibly damaging Het
Cubn T C 2: 13,287,819 (GRCm39) D3420G probably damaging Het
Cyp2u1 A G 3: 131,087,135 (GRCm39) F482S possibly damaging Het
Foxo1 T A 3: 52,253,701 (GRCm39) D621E probably benign Het
Grid2 A G 6: 64,322,826 (GRCm39) M609V possibly damaging Het
Hsd17b3 A T 13: 64,236,876 (GRCm39) F23I possibly damaging Het
Kcnk10 A G 12: 98,407,003 (GRCm39) I217T probably benign Het
Mis18bp1 G A 12: 65,195,916 (GRCm39) S616L possibly damaging Het
Mtch1 A T 17: 29,561,806 (GRCm39) F133I probably damaging Het
Myh4 T A 11: 67,149,931 (GRCm39) V1830E possibly damaging Het
Nav3 T C 10: 109,689,237 (GRCm39) M347V possibly damaging Het
Nbea A G 3: 55,993,713 (GRCm39) probably benign Het
Nhej1 A T 1: 75,008,042 (GRCm39) D76E probably benign Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or5m12 A C 2: 85,735,081 (GRCm39) C106G probably damaging Het
Pias3 T C 3: 96,609,526 (GRCm39) V307A probably benign Het
Pltp T A 2: 164,696,208 (GRCm39) M135L probably benign Het
Plxna2 A G 1: 194,476,098 (GRCm39) Y1106C probably damaging Het
Pramel26 T C 4: 143,538,545 (GRCm39) E142G probably damaging Het
Ptgir G A 7: 16,641,311 (GRCm39) R201H probably damaging Het
Ptk7 A T 17: 46,897,344 (GRCm39) D329E probably benign Het
Pygl T C 12: 70,245,217 (GRCm39) D411G probably benign Het
Sfrp1 T C 8: 23,902,264 (GRCm39) L155P probably damaging Het
Slc5a4a A G 10: 76,024,983 (GRCm39) E620G probably damaging Het
Smarca2 A G 19: 26,698,273 (GRCm39) I1314V probably benign Het
Tas2r109 G A 6: 132,957,766 (GRCm39) L55F probably damaging Het
Tek T A 4: 94,693,109 (GRCm39) C274S probably damaging Het
Tektl1 T C 10: 78,584,532 (GRCm39) N330S probably benign Het
Tent4b A T 8: 88,977,292 (GRCm39) I322F possibly damaging Het
Tmem38b T A 4: 53,859,905 (GRCm39) D228E probably benign Het
Topbp1 T C 9: 103,187,122 (GRCm39) V109A possibly damaging Het
Trbv5 A G 6: 41,039,682 (GRCm39) I96V probably benign Het
Trim16 T G 11: 62,727,498 (GRCm39) probably benign Het
Upf3a A T 8: 13,848,238 (GRCm39) T345S probably benign Het
Usp15 A G 10: 122,955,040 (GRCm39) S913P probably damaging Het
Vmn2r124 T A 17: 18,293,953 (GRCm39) V680D possibly damaging Het
Vmn2r91 G A 17: 18,327,860 (GRCm39) V485I probably benign Het
Zdbf2 A T 1: 63,347,483 (GRCm39) H1954L possibly damaging Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38,138,021 (GRCm39) missense probably damaging 1.00
IGL01065:Rev1 APN 1 38,138,090 (GRCm39) missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38,131,144 (GRCm39) missense probably damaging 1.00
IGL03003:Rev1 APN 1 38,127,154 (GRCm39) missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38,095,848 (GRCm39) missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38,095,337 (GRCm39) unclassified probably benign
R0409:Rev1 UTSW 1 38,113,449 (GRCm39) nonsense probably null
R0606:Rev1 UTSW 1 38,098,204 (GRCm39) missense probably null 1.00
R1134:Rev1 UTSW 1 38,096,768 (GRCm39) missense probably benign 0.04
R1171:Rev1 UTSW 1 38,127,581 (GRCm39) missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38,098,199 (GRCm39) unclassified probably benign
R1440:Rev1 UTSW 1 38,127,286 (GRCm39) missense probably damaging 1.00
R1485:Rev1 UTSW 1 38,127,653 (GRCm39) missense probably benign 0.00
R1627:Rev1 UTSW 1 38,094,571 (GRCm39) missense probably damaging 0.99
R3948:Rev1 UTSW 1 38,113,414 (GRCm39) missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38,093,319 (GRCm39) missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38,093,319 (GRCm39) missense possibly damaging 0.50
R4076:Rev1 UTSW 1 38,093,319 (GRCm39) missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38,146,729 (GRCm39) missense possibly damaging 0.87
R4293:Rev1 UTSW 1 38,147,500 (GRCm39) missense possibly damaging 0.89
R4548:Rev1 UTSW 1 38,098,275 (GRCm39) missense possibly damaging 0.72
R4610:Rev1 UTSW 1 38,092,730 (GRCm39) missense probably damaging 1.00
R4654:Rev1 UTSW 1 38,118,337 (GRCm39) intron probably benign
R5032:Rev1 UTSW 1 38,113,570 (GRCm39) intron probably benign
R5286:Rev1 UTSW 1 38,094,407 (GRCm39) nonsense probably null
R5311:Rev1 UTSW 1 38,118,474 (GRCm39) missense probably benign 0.00
R5327:Rev1 UTSW 1 38,147,532 (GRCm39) nonsense probably null
R6363:Rev1 UTSW 1 38,110,570 (GRCm39) missense probably damaging 1.00
R7050:Rev1 UTSW 1 38,093,352 (GRCm39) missense probably damaging 1.00
R7072:Rev1 UTSW 1 38,106,626 (GRCm39) nonsense probably null
R7132:Rev1 UTSW 1 38,110,530 (GRCm39) missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38,124,682 (GRCm39) missense probably damaging 1.00
R7298:Rev1 UTSW 1 38,092,185 (GRCm39) missense probably damaging 1.00
R7367:Rev1 UTSW 1 38,113,488 (GRCm39) nonsense probably null
R7395:Rev1 UTSW 1 38,127,146 (GRCm39) missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38,095,526 (GRCm39) missense probably damaging 0.98
R8053:Rev1 UTSW 1 38,102,222 (GRCm39) missense possibly damaging 0.67
R8093:Rev1 UTSW 1 38,114,097 (GRCm39) intron probably benign
R8356:Rev1 UTSW 1 38,098,324 (GRCm39) nonsense probably null
R8456:Rev1 UTSW 1 38,098,324 (GRCm39) nonsense probably null
R8461:Rev1 UTSW 1 38,122,868 (GRCm39) missense possibly damaging 0.56
R8724:Rev1 UTSW 1 38,127,150 (GRCm39) missense probably damaging 1.00
R8757:Rev1 UTSW 1 38,098,353 (GRCm39) missense probably damaging 1.00
R8759:Rev1 UTSW 1 38,098,353 (GRCm39) missense probably damaging 1.00
R8945:Rev1 UTSW 1 38,122,824 (GRCm39) missense probably damaging 0.98
R9309:Rev1 UTSW 1 38,093,945 (GRCm39) missense probably damaging 1.00
R9433:Rev1 UTSW 1 38,092,173 (GRCm39) missense probably damaging 1.00
R9500:Rev1 UTSW 1 38,102,214 (GRCm39) nonsense probably null
X0017:Rev1 UTSW 1 38,092,742 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCAGACACATGCTATTTG -3'
(R):5'- TGTGTCAAGGCAGGATAGC -3'

Sequencing Primer
(F):5'- GACACATGCTATTTGAAAGTAAGGCC -3'
(R):5'- GTCAAGGCAGGATAGCTTTATCACTC -3'
Posted On 2015-04-06