Incidental Mutation 'R3845:Gm13084'
ID277319
Institutional Source Beutler Lab
Gene Symbol Gm13084
Ensembl Gene ENSMUSG00000059218
Gene Namepredicted gene 13084
Synonyms
MMRRC Submission 040893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3845 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143809245-143816093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143811975 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000101395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075045
AA Change: E142G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: E142G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105769
AA Change: E142G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218
AA Change: E142G

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137635
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apool A T X: 112,364,458 probably benign Het
Atp4a A G 7: 30,717,115 N439S probably null Het
AU041133 T A 10: 82,151,318 H268Q probably damaging Het
Ccdc105 T C 10: 78,748,698 N330S probably benign Het
Ccdc136 C T 6: 29,417,177 R666W probably benign Het
Ccdc97 T C 7: 25,715,028 probably benign Het
Celf1 T C 2: 91,009,238 V336A possibly damaging Het
Chd3 T C 11: 69,346,759 N1870D possibly damaging Het
Col5a3 C T 9: 20,808,377 D229N unknown Het
Cpn1 G T 19: 43,974,084 P142Q possibly damaging Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Cyp2u1 A G 3: 131,293,486 F482S possibly damaging Het
Foxo1 T A 3: 52,346,280 D621E probably benign Het
Gm5346 T C 8: 43,626,632 N185S probably benign Het
Grid2 A G 6: 64,345,842 M609V possibly damaging Het
Hsd17b3 A T 13: 64,089,062 F23I possibly damaging Het
Kcnk10 A G 12: 98,440,744 I217T probably benign Het
Mis18bp1 G A 12: 65,149,142 S616L possibly damaging Het
Mtch1 A T 17: 29,342,832 F133I probably damaging Het
Myh4 T A 11: 67,259,105 V1830E possibly damaging Het
Nav3 T C 10: 109,853,376 M347V possibly damaging Het
Nbea A G 3: 56,086,292 probably benign Het
Nhej1 A T 1: 74,968,883 D76E probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1024 A C 2: 85,904,737 C106G probably damaging Het
Papd5 A T 8: 88,250,664 I322F possibly damaging Het
Pias3 T C 3: 96,702,210 V307A probably benign Het
Pltp T A 2: 164,854,288 M135L probably benign Het
Plxna2 A G 1: 194,793,790 Y1106C probably damaging Het
Ptgir G A 7: 16,907,386 R201H probably damaging Het
Ptk7 A T 17: 46,586,418 D329E probably benign Het
Pygl T C 12: 70,198,443 D411G probably benign Het
Rev1 A T 1: 38,098,988 M72K probably damaging Het
Sfrp1 T C 8: 23,412,248 L155P probably damaging Het
Slc5a4a A G 10: 76,189,149 E620G probably damaging Het
Smarca2 A G 19: 26,720,873 I1314V probably benign Het
Tas2r109 G A 6: 132,980,803 L55F probably damaging Het
Tek T A 4: 94,804,872 C274S probably damaging Het
Tmem38b T A 4: 53,859,905 D228E probably benign Het
Topbp1 T C 9: 103,309,923 V109A possibly damaging Het
Trbv5 A G 6: 41,062,748 I96V probably benign Het
Trim16 T G 11: 62,836,672 probably benign Het
Upf3a A T 8: 13,798,238 T345S probably benign Het
Usp15 A G 10: 123,119,135 S913P probably damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Zdbf2 A T 1: 63,308,324 H1954L possibly damaging Het
Other mutations in Gm13084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Gm13084 APN 4 143812723 missense probably benign 0.32
IGL01075:Gm13084 APN 4 143811646 missense possibly damaging 0.47
IGL02705:Gm13084 APN 4 143810802 missense probably damaging 1.00
IGL03011:Gm13084 APN 4 143811760 missense possibly damaging 0.95
PIT4498001:Gm13084 UTSW 4 143812836 missense possibly damaging 0.63
R0268:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0344:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0390:Gm13084 UTSW 4 143811699 missense probably benign 0.09
R0597:Gm13084 UTSW 4 143812652 missense probably damaging 0.98
R0646:Gm13084 UTSW 4 143812585 missense possibly damaging 0.83
R0927:Gm13084 UTSW 4 143812808 missense probably benign 0.05
R0973:Gm13084 UTSW 4 143811858 missense probably damaging 1.00
R1851:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R1852:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R3699:Gm13084 UTSW 4 143810352 missense probably benign 0.05
R3705:Gm13084 UTSW 4 143811775 missense probably benign 0.06
R4035:Gm13084 UTSW 4 143810456 missense probably benign 0.08
R4044:Gm13084 UTSW 4 143811600 missense probably benign 0.34
R4439:Gm13084 UTSW 4 143811573 missense possibly damaging 0.49
R4660:Gm13084 UTSW 4 143811865 missense probably benign 0.19
R4770:Gm13084 UTSW 4 143811949 missense probably damaging 0.96
R4838:Gm13084 UTSW 4 143810805 nonsense probably null
R5534:Gm13084 UTSW 4 143812599 nonsense probably null
R5691:Gm13084 UTSW 4 143812009 missense probably benign 0.44
R5893:Gm13084 UTSW 4 143810468 missense probably damaging 1.00
R6123:Gm13084 UTSW 4 143812764 missense possibly damaging 0.89
R6285:Gm13084 UTSW 4 143816039 missense probably damaging 1.00
R6886:Gm13084 UTSW 4 143812762 missense probably benign 0.29
R7105:Gm13084 UTSW 4 143810771 missense probably benign 0.04
R7135:Gm13084 UTSW 4 143810663 missense probably damaging 1.00
R7474:Gm13084 UTSW 4 143811699 missense probably benign 0.03
R7594:Gm13084 UTSW 4 143812716 missense probably damaging 0.99
R7610:Gm13084 UTSW 4 143812866 missense probably damaging 1.00
R7635:Gm13084 UTSW 4 143810417 missense probably damaging 1.00
R7682:Gm13084 UTSW 4 143810720 missense probably benign 0.38
Z1177:Gm13084 UTSW 4 143812018 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AACATTTCTATGACTGTGGCTTTGG -3'
(R):5'- GGTTTCATTCTAGGCACAGGAATAAG -3'

Sequencing Primer
(F):5'- GCCATAAATTTTCAGCTTTCTACAG -3'
(R):5'- GCACAGGAATAAGCAAAGTTTTG -3'
Posted On2015-04-06