Mutagenetix > Incidental Mutation

Incidental Mutation 'R3845:Atp4a'

277325

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

040893-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R3845 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30717115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 439 (N439S)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000005692
AA Change: N439S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: N439S

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably null
Transcript: ENSMUST00000170371
AA Change: N439S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: N439S

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.3569

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apool	A	T	X: 112,364,458		probably benign	Het
AU041133	T	A	10: 82,151,318	H268Q	probably damaging	Het
Ccdc105	T	C	10: 78,748,698	N330S	probably benign	Het
Ccdc136	C	T	6: 29,417,177	R666W	probably benign	Het
Ccdc97	T	C	7: 25,715,028		probably benign	Het
Celf1	T	C	2: 91,009,238	V336A	possibly damaging	Het
Chd3	T	C	11: 69,346,759	N1870D	possibly damaging	Het
Col5a3	C	T	9: 20,808,377	D229N	unknown	Het
Cpn1	G	T	19: 43,974,084	P142Q	possibly damaging	Het
Cubn	T	C	2: 13,283,008	D3420G	probably damaging	Het
Cyp2u1	A	G	3: 131,293,486	F482S	possibly damaging	Het
Foxo1	T	A	3: 52,346,280	D621E	probably benign	Het
Gm13084	T	C	4: 143,811,975	E142G	probably damaging	Het
Gm5346	T	C	8: 43,626,632	N185S	probably benign	Het
Grid2	A	G	6: 64,345,842	M609V	possibly damaging	Het
Hsd17b3	A	T	13: 64,089,062	F23I	possibly damaging	Het
Kcnk10	A	G	12: 98,440,744	I217T	probably benign	Het
Mis18bp1	G	A	12: 65,149,142	S616L	possibly damaging	Het
Mtch1	A	T	17: 29,342,832	F133I	probably damaging	Het
Myh4	T	A	11: 67,259,105	V1830E	possibly damaging	Het
Nav3	T	C	10: 109,853,376	M347V	possibly damaging	Het
Nbea	A	G	3: 56,086,292		probably benign	Het
Nhej1	A	T	1: 74,968,883	D76E	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1024	A	C	2: 85,904,737	C106G	probably damaging	Het
Papd5	A	T	8: 88,250,664	I322F	possibly damaging	Het
Pias3	T	C	3: 96,702,210	V307A	probably benign	Het
Pltp	T	A	2: 164,854,288	M135L	probably benign	Het
Plxna2	A	G	1: 194,793,790	Y1106C	probably damaging	Het
Ptgir	G	A	7: 16,907,386	R201H	probably damaging	Het
Ptk7	A	T	17: 46,586,418	D329E	probably benign	Het
Pygl	T	C	12: 70,198,443	D411G	probably benign	Het
Rev1	A	T	1: 38,098,988	M72K	probably damaging	Het
Sfrp1	T	C	8: 23,412,248	L155P	probably damaging	Het
Slc5a4a	A	G	10: 76,189,149	E620G	probably damaging	Het
Smarca2	A	G	19: 26,720,873	I1314V	probably benign	Het
Tas2r109	G	A	6: 132,980,803	L55F	probably damaging	Het
Tek	T	A	4: 94,804,872	C274S	probably damaging	Het
Tmem38b	T	A	4: 53,859,905	D228E	probably benign	Het
Topbp1	T	C	9: 103,309,923	V109A	possibly damaging	Het
Trbv5	A	G	6: 41,062,748	I96V	probably benign	Het
Trim16	T	G	11: 62,836,672		probably benign	Het
Upf3a	A	T	8: 13,798,238	T345S	probably benign	Het
Usp15	A	G	10: 123,119,135	S913P	probably damaging	Het
Vmn2r124	T	A	17: 18,073,691	V680D	possibly damaging	Het
Vmn2r91	G	A	17: 18,107,598	V485I	probably benign	Het
Zdbf2	A	T	1: 63,308,324	H1954L	possibly damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACTCTCCATGCCTGGGAAG -3'
(R):5'- TCGCAAACTTTGGGGAAGC -3'

Sequencing Primer
(F):5'- CATGCCTGGGAAGGGGAC -3'
(R):5'- TGTAACCCATGGCGTTGC -3'

Posted On

2015-04-06