Incidental Mutation 'R3845:Chd3'
ID277340
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Namechromodomain helicase DNA binding protein 3
SynonymsChd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
MMRRC Submission 040893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3845 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location69343273-69369406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69346759 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1870 (N1870D)
Ref Sequence ENSEMBL: ENSMUSP00000104301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000129321] [ENSMUST00000218008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092971
AA Change: N1836D

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: N1836D

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108661
AA Change: N1870D

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: N1870D

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122992
Predicted Effect unknown
Transcript: ENSMUST00000128981
AA Change: N1742D
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: N1742D

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157256
Predicted Effect probably benign
Transcript: ENSMUST00000218008
Meta Mutation Damage Score 0.6306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apool A T X: 112,364,458 probably benign Het
Atp4a A G 7: 30,717,115 N439S probably null Het
AU041133 T A 10: 82,151,318 H268Q probably damaging Het
Ccdc105 T C 10: 78,748,698 N330S probably benign Het
Ccdc136 C T 6: 29,417,177 R666W probably benign Het
Ccdc97 T C 7: 25,715,028 probably benign Het
Celf1 T C 2: 91,009,238 V336A possibly damaging Het
Col5a3 C T 9: 20,808,377 D229N unknown Het
Cpn1 G T 19: 43,974,084 P142Q possibly damaging Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Cyp2u1 A G 3: 131,293,486 F482S possibly damaging Het
Foxo1 T A 3: 52,346,280 D621E probably benign Het
Gm13084 T C 4: 143,811,975 E142G probably damaging Het
Gm5346 T C 8: 43,626,632 N185S probably benign Het
Grid2 A G 6: 64,345,842 M609V possibly damaging Het
Hsd17b3 A T 13: 64,089,062 F23I possibly damaging Het
Kcnk10 A G 12: 98,440,744 I217T probably benign Het
Mis18bp1 G A 12: 65,149,142 S616L possibly damaging Het
Mtch1 A T 17: 29,342,832 F133I probably damaging Het
Myh4 T A 11: 67,259,105 V1830E possibly damaging Het
Nav3 T C 10: 109,853,376 M347V possibly damaging Het
Nbea A G 3: 56,086,292 probably benign Het
Nhej1 A T 1: 74,968,883 D76E probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1024 A C 2: 85,904,737 C106G probably damaging Het
Papd5 A T 8: 88,250,664 I322F possibly damaging Het
Pias3 T C 3: 96,702,210 V307A probably benign Het
Pltp T A 2: 164,854,288 M135L probably benign Het
Plxna2 A G 1: 194,793,790 Y1106C probably damaging Het
Ptgir G A 7: 16,907,386 R201H probably damaging Het
Ptk7 A T 17: 46,586,418 D329E probably benign Het
Pygl T C 12: 70,198,443 D411G probably benign Het
Rev1 A T 1: 38,098,988 M72K probably damaging Het
Sfrp1 T C 8: 23,412,248 L155P probably damaging Het
Slc5a4a A G 10: 76,189,149 E620G probably damaging Het
Smarca2 A G 19: 26,720,873 I1314V probably benign Het
Tas2r109 G A 6: 132,980,803 L55F probably damaging Het
Tek T A 4: 94,804,872 C274S probably damaging Het
Tmem38b T A 4: 53,859,905 D228E probably benign Het
Topbp1 T C 9: 103,309,923 V109A possibly damaging Het
Trbv5 A G 6: 41,062,748 I96V probably benign Het
Trim16 T G 11: 62,836,672 probably benign Het
Upf3a A T 8: 13,798,238 T345S probably benign Het
Usp15 A G 10: 123,119,135 S913P probably damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Zdbf2 A T 1: 63,308,324 H1954L possibly damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69357062 missense probably damaging 0.96
IGL00551:Chd3 APN 11 69346629 missense probably damaging 1.00
IGL00661:Chd3 APN 11 69357383 missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69349871 missense probably damaging 0.98
IGL01075:Chd3 APN 11 69359965 missense probably damaging 1.00
IGL01309:Chd3 APN 11 69357731 missense probably damaging 0.99
IGL01317:Chd3 APN 11 69353211 missense probably damaging 1.00
IGL01374:Chd3 APN 11 69359980 missense probably damaging 0.99
IGL01444:Chd3 APN 11 69348742 missense probably benign 0.28
IGL01617:Chd3 APN 11 69358234 unclassified probably benign
IGL01635:Chd3 APN 11 69361250 splice site probably benign
IGL01942:Chd3 APN 11 69350105 critical splice donor site probably null
IGL01962:Chd3 APN 11 69357493 missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69360675 missense probably damaging 0.99
IGL02022:Chd3 APN 11 69361060 missense probably damaging 1.00
IGL02098:Chd3 APN 11 69359829 missense probably damaging 1.00
IGL02218:Chd3 APN 11 69352094 unclassified probably benign
IGL02415:Chd3 APN 11 69348913 splice site probably benign
IGL02648:Chd3 APN 11 69352150 missense probably damaging 1.00
IGL02951:Chd3 APN 11 69361048 critical splice donor site probably null
IGL03030:Chd3 APN 11 69354404 missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69361196 nonsense probably null
IGL03168:Chd3 APN 11 69348915 splice site probably benign
IGL03327:Chd3 APN 11 69350186 missense probably damaging 1.00
burg UTSW 11 69356554 missense probably damaging 1.00
Fortress UTSW 11 69364050 nonsense probably null
Redoubt UTSW 11 69353901 unclassified probably benign
schloss UTSW 11 69362060 nonsense probably null
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0056:Chd3 UTSW 11 69359913 unclassified probably benign
R0129:Chd3 UTSW 11 69348501 nonsense probably null
R0130:Chd3 UTSW 11 69359830 missense probably damaging 1.00
R0309:Chd3 UTSW 11 69357018 missense probably damaging 1.00
R0330:Chd3 UTSW 11 69356333 missense probably damaging 1.00
R0449:Chd3 UTSW 11 69357541 missense probably damaging 0.98
R0502:Chd3 UTSW 11 69354105 missense probably damaging 0.98
R0540:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0571:Chd3 UTSW 11 69361669 critical splice donor site probably null
R0607:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0616:Chd3 UTSW 11 69345487 missense probably damaging 0.96
R0630:Chd3 UTSW 11 69347195 missense probably damaging 1.00
R1436:Chd3 UTSW 11 69357574 splice site probably null
R1484:Chd3 UTSW 11 69359899 missense probably benign 0.17
R1741:Chd3 UTSW 11 69355654 missense probably damaging 1.00
R1748:Chd3 UTSW 11 69364697 missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69353901 unclassified probably benign
R1833:Chd3 UTSW 11 69354123 missense probably damaging 1.00
R2012:Chd3 UTSW 11 69349052 missense probably benign 0.01
R2101:Chd3 UTSW 11 69349051 missense probably benign
R2147:Chd3 UTSW 11 69349028 missense probably benign 0.00
R2513:Chd3 UTSW 11 69360645 missense probably damaging 1.00
R2877:Chd3 UTSW 11 69361172 nonsense probably null
R2879:Chd3 UTSW 11 69364098 missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2881:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2973:Chd3 UTSW 11 69360616 missense probably damaging 1.00
R3611:Chd3 UTSW 11 69362147 missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69364050 nonsense probably null
R3889:Chd3 UTSW 11 69359185 missense probably damaging 0.98
R4007:Chd3 UTSW 11 69349001 missense probably benign
R4115:Chd3 UTSW 11 69357517 missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69349877 missense probably benign 0.00
R4612:Chd3 UTSW 11 69353209 nonsense probably null
R4622:Chd3 UTSW 11 69349008 missense probably damaging 0.98
R4634:Chd3 UTSW 11 69362187 unclassified probably benign
R4635:Chd3 UTSW 11 69362187 unclassified probably benign
R4859:Chd3 UTSW 11 69359896 missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69354208 unclassified probably benign
R5173:Chd3 UTSW 11 69369243 unclassified probably benign
R5287:Chd3 UTSW 11 69349069 splice site probably null
R5403:Chd3 UTSW 11 69349069 splice site probably null
R5511:Chd3 UTSW 11 69361475 missense probably damaging 1.00
R5666:Chd3 UTSW 11 69353351 missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69361435 missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69352118 missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69349237 missense probably benign
R6211:Chd3 UTSW 11 69352677 missense probably damaging 1.00
R6215:Chd3 UTSW 11 69356554 missense probably damaging 1.00
R6217:Chd3 UTSW 11 69345535 missense probably damaging 1.00
R6302:Chd3 UTSW 11 69353778 missense probably damaging 0.98
R6329:Chd3 UTSW 11 69361684 missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69364031 missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69352545 critical splice donor site probably null
R6453:Chd3 UTSW 11 69350112 nonsense probably null
R6548:Chd3 UTSW 11 69362060 nonsense probably null
R6582:Chd3 UTSW 11 69369156 unclassified probably benign
R6721:Chd3 UTSW 11 69369219 unclassified probably benign
R6776:Chd3 UTSW 11 69354470 missense probably damaging 1.00
R6900:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69369201 missense unknown
R7136:Chd3 UTSW 11 69348438 missense probably null 0.37
R7164:Chd3 UTSW 11 69362306 missense probably damaging 1.00
R7200:Chd3 UTSW 11 69364095 missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69369211 missense unknown
R7238:Chd3 UTSW 11 69364047 missense probably benign 0.31
R7316:Chd3 UTSW 11 69345568 missense probably damaging 0.99
R7560:Chd3 UTSW 11 69356270 missense probably damaging 1.00
R7684:Chd3 UTSW 11 69357866 missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69355633 missense probably benign 0.00
R7820:Chd3 UTSW 11 69353238 missense probably damaging 1.00
R7885:Chd3 UTSW 11 69356625 missense probably benign 0.13
R8150:Chd3 UTSW 11 69363684 missense probably benign 0.02
R8161:Chd3 UTSW 11 69350885 missense probably damaging 1.00
R8271:Chd3 UTSW 11 69360657 missense probably damaging 1.00
X0022:Chd3 UTSW 11 69356258 missense probably damaging 1.00
X0062:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGAAGACTTACGCAGCGTTG -3'
(R):5'- CCCAAGTGGACCTTCTGATG -3'

Sequencing Primer
(F):5'- CTTACGCAGCGTTGTGGGC -3'
(R):5'- CAAGTGGACCTTCTGATGGGAAC -3'
Posted On2015-04-06