Incidental Mutation 'R3846:Olfr1118'
ID277365
Institutional Source Beutler Lab
Gene Symbol Olfr1118
Ensembl Gene ENSMUSG00000083706
Gene Nameolfactory receptor 1118
SynonymsMOR264-22, Olfr1118-ps, GA_x6K02T2Q125-48795705-48796673
MMRRC Submission 040894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3846 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87307581-87313621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87309182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 151 (V151A)
Ref Sequence ENSEMBL: ENSMUSP00000150394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090717] [ENSMUST00000121296] [ENSMUST00000216396]
Predicted Effect probably benign
Transcript: ENSMUST00000090717
AA Change: V131A

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132837
Gene: ENSMUSG00000070855
AA Change: V131A

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.1e-53 PFAM
Pfam:7tm_1 32 281 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120328
Predicted Effect probably benign
Transcript: ENSMUST00000121296
AA Change: V131A

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144143
Gene: ENSMUSG00000083706
AA Change: V131A

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.2e-51 PFAM
Pfam:7tm_1 32 281 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216396
AA Change: V151A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.2603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,354,558 Y261H probably damaging Het
Acad10 T A 5: 121,634,686 I511F probably benign Het
Adgb G A 10: 10,382,721 probably benign Het
Adgrg3 T C 8: 95,040,421 V468A probably benign Het
Ano4 A T 10: 88,995,252 I468N possibly damaging Het
Apool A T X: 112,364,458 probably benign Het
Arhgap32 T C 9: 32,190,024 V295A probably benign Het
Ccser2 A G 14: 36,940,288 V313A probably benign Het
Ctnnd1 T C 2: 84,616,927 I325V probably benign Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Dnah12 A G 14: 26,710,211 T395A probably benign Het
Dock2 T G 11: 34,732,371 H65P possibly damaging Het
Fsip2 A T 2: 82,986,415 Q4164L possibly damaging Het
Gapvd1 A T 2: 34,729,072 Y96* probably null Het
Gja3 T A 14: 57,035,704 K404* probably null Het
Gm10093 A G 17: 78,492,972 K464R possibly damaging Het
Gm9866 T A 12: 27,160,302 noncoding transcript Het
Hmcn2 A G 2: 31,430,350 I3948V possibly damaging Het
Hr C T 14: 70,571,453 R1090W probably damaging Het
Hrnr A G 3: 93,332,157 H3234R unknown Het
Ifi207 T A 1: 173,735,303 E92D probably benign Het
Iqgap2 G A 13: 95,673,678 probably benign Het
Itgax G T 7: 128,133,767 V273F probably damaging Het
Lamc3 A G 2: 31,924,592 M1043V probably benign Het
Lgmn T C 12: 102,404,329 N114S possibly damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Notch4 A G 17: 34,578,097 T940A probably damaging Het
Nudt15 T A 14: 73,523,471 Q60L probably benign Het
Olfr676 T C 7: 105,035,689 C164R probably benign Het
Phip G A 9: 82,876,126 R1505* probably null Het
Ptger2 T G 14: 44,989,327 S121R probably damaging Het
Scyl2 A T 10: 89,640,541 F907L probably damaging Het
Trpc4 C A 3: 54,318,012 F843L probably benign Het
Tysnd1 C T 10: 61,696,088 S173L possibly damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Other mutations in Olfr1118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1118 APN 2 87309581 missense possibly damaging 0.95
IGL01458:Olfr1118 APN 2 87309482 missense probably damaging 1.00
IGL02544:Olfr1118 APN 2 87309127 missense possibly damaging 0.91
IGL02748:Olfr1118 APN 2 87309665 missense probably damaging 1.00
IGL03077:Olfr1118 APN 2 87309712 makesense probably null
R0411:Olfr1118 UTSW 2 87309058 missense probably benign 0.07
R0525:Olfr1118 UTSW 2 87309349 missense probably benign 0.10
R1703:Olfr1118 UTSW 2 87309410 missense probably benign 0.00
R1750:Olfr1118 UTSW 2 87308852 missense probably benign 0.02
R2005:Olfr1118 UTSW 2 87309448 missense probably benign 0.24
R2090:Olfr1118 UTSW 2 87309418 missense probably benign 0.02
R4011:Olfr1118 UTSW 2 87309211 missense probably benign 0.03
R4077:Olfr1118 UTSW 2 87308864 splice site probably null 0.42
R5132:Olfr1118 UTSW 2 87308938 missense probably damaging 1.00
R5368:Olfr1118 UTSW 2 87308782 splice site probably null
R7355:Olfr1118 UTSW 2 87309410 missense probably benign 0.00
R7405:Olfr1118 UTSW 2 87308995 missense probably benign 0.00
R7437:Olfr1118 UTSW 2 87309343 missense probably benign
R7554:Olfr1118 UTSW 2 87309005 missense probably damaging 1.00
R7609:Olfr1118 UTSW 2 87309509 missense probably benign 0.01
R8156:Olfr1118 UTSW 2 87308974 missense probably damaging 0.97
R8482:Olfr1118 UTSW 2 87309382 missense probably benign 0.07
RF010:Olfr1118 UTSW 2 87308840 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTACTATTCCAAGAATGCTTATGG -3'
(R):5'- CCATCCCTTTGGCTGAAGAC -3'

Sequencing Primer
(F):5'- ACAGAGTGCCTCTTGCT -3'
(R):5'- CCTTTGGCTGAAGACAGTTTC -3'
Posted On2015-04-06