Incidental Mutation 'R3846:Olfr676'
ID277371
Institutional Source Beutler Lab
Gene Symbol Olfr676
Ensembl Gene ENSMUSG00000073915
Gene Nameolfactory receptor 676
SynonymsMOR32-1, GA_x6K02T2PBJ9-7664016-7664969
MMRRC Submission 040894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3846 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105032698-105037750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105035689 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 164 (C164R)
Ref Sequence ENSEMBL: ENSMUSP00000151474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098162] [ENSMUST00000219602]
Predicted Effect probably benign
Transcript: ENSMUST00000098162
AA Change: C164R

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095765
Gene: ENSMUSG00000073915
AA Change: C164R

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 3e-113 PFAM
Pfam:7TM_GPCR_Srsx 45 316 4.5e-7 PFAM
Pfam:7tm_1 51 301 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219042
Predicted Effect probably benign
Transcript: ENSMUST00000219602
AA Change: C164R

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,354,558 Y261H probably damaging Het
Acad10 T A 5: 121,634,686 I511F probably benign Het
Adgb G A 10: 10,382,721 probably benign Het
Adgrg3 T C 8: 95,040,421 V468A probably benign Het
Ano4 A T 10: 88,995,252 I468N possibly damaging Het
Apool A T X: 112,364,458 probably benign Het
Arhgap32 T C 9: 32,190,024 V295A probably benign Het
Ccser2 A G 14: 36,940,288 V313A probably benign Het
Ctnnd1 T C 2: 84,616,927 I325V probably benign Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Dnah12 A G 14: 26,710,211 T395A probably benign Het
Dock2 T G 11: 34,732,371 H65P possibly damaging Het
Fsip2 A T 2: 82,986,415 Q4164L possibly damaging Het
Gapvd1 A T 2: 34,729,072 Y96* probably null Het
Gja3 T A 14: 57,035,704 K404* probably null Het
Gm10093 A G 17: 78,492,972 K464R possibly damaging Het
Gm9866 T A 12: 27,160,302 noncoding transcript Het
Hmcn2 A G 2: 31,430,350 I3948V possibly damaging Het
Hr C T 14: 70,571,453 R1090W probably damaging Het
Hrnr A G 3: 93,332,157 H3234R unknown Het
Ifi207 T A 1: 173,735,303 E92D probably benign Het
Iqgap2 G A 13: 95,673,678 probably benign Het
Itgax G T 7: 128,133,767 V273F probably damaging Het
Lamc3 A G 2: 31,924,592 M1043V probably benign Het
Lgmn T C 12: 102,404,329 N114S possibly damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Notch4 A G 17: 34,578,097 T940A probably damaging Het
Nudt15 T A 14: 73,523,471 Q60L probably benign Het
Olfr1118 T C 2: 87,309,182 V151A probably benign Het
Phip G A 9: 82,876,126 R1505* probably null Het
Ptger2 T G 14: 44,989,327 S121R probably damaging Het
Scyl2 A T 10: 89,640,541 F907L probably damaging Het
Trpc4 C A 3: 54,318,012 F843L probably benign Het
Tysnd1 C T 10: 61,696,088 S173L possibly damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Other mutations in Olfr676
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr676 APN 7 105035390 missense probably benign
IGL02244:Olfr676 APN 7 105035945 missense probably damaging 1.00
IGL03493:Olfr676 APN 7 105035944 missense probably damaging 1.00
R1181:Olfr676 UTSW 7 105035814 missense probably damaging 1.00
R1223:Olfr676 UTSW 7 105035566 missense probably benign 0.01
R1460:Olfr676 UTSW 7 105035708 missense possibly damaging 0.80
R1768:Olfr676 UTSW 7 105035950 missense probably benign 0.00
R2256:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R2257:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R4486:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4488:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4489:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4598:Olfr676 UTSW 7 105036073 missense probably benign 0.19
R4599:Olfr676 UTSW 7 105036073 missense probably benign 0.00
R4701:Olfr676 UTSW 7 105035591 missense probably damaging 1.00
R4855:Olfr676 UTSW 7 105035651 missense probably damaging 0.99
R5083:Olfr676 UTSW 7 105035411 missense probably damaging 1.00
R5743:Olfr676 UTSW 7 105036156 splice site probably null
R5798:Olfr676 UTSW 7 105036137 missense probably benign 0.00
R6279:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R6300:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R7400:Olfr676 UTSW 7 105035210 missense probably benign
R7672:Olfr676 UTSW 7 105035543 missense probably damaging 1.00
R7698:Olfr676 UTSW 7 105035907 missense probably benign 0.01
R8468:Olfr676 UTSW 7 105035746 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTGCTGTGTTGCTCAAGTC -3'
(R):5'- TTAGGCGAGCATCTTGAGAAG -3'

Sequencing Primer
(F):5'- GTGGCTATTTGCAACCCT -3'
(R):5'- ACGGCATATAAGATCCTAGCATAG -3'
Posted On2015-04-06