Incidental Mutation 'R3846:Itgax'
ID277372
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 040894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3846 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128133767 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 273 (V273F)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000205460]
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: V273F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: V273F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Predicted Effect probably benign
Transcript: ENSMUST00000205460
Meta Mutation Damage Score 0.5313 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,354,558 Y261H probably damaging Het
Acad10 T A 5: 121,634,686 I511F probably benign Het
Adgb G A 10: 10,382,721 probably benign Het
Adgrg3 T C 8: 95,040,421 V468A probably benign Het
Ano4 A T 10: 88,995,252 I468N possibly damaging Het
Apool A T X: 112,364,458 probably benign Het
Arhgap32 T C 9: 32,190,024 V295A probably benign Het
Ccser2 A G 14: 36,940,288 V313A probably benign Het
Ctnnd1 T C 2: 84,616,927 I325V probably benign Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Dnah12 A G 14: 26,710,211 T395A probably benign Het
Dock2 T G 11: 34,732,371 H65P possibly damaging Het
Fsip2 A T 2: 82,986,415 Q4164L possibly damaging Het
Gapvd1 A T 2: 34,729,072 Y96* probably null Het
Gja3 T A 14: 57,035,704 K404* probably null Het
Gm10093 A G 17: 78,492,972 K464R possibly damaging Het
Gm9866 T A 12: 27,160,302 noncoding transcript Het
Hmcn2 A G 2: 31,430,350 I3948V possibly damaging Het
Hr C T 14: 70,571,453 R1090W probably damaging Het
Hrnr A G 3: 93,332,157 H3234R unknown Het
Ifi207 T A 1: 173,735,303 E92D probably benign Het
Iqgap2 G A 13: 95,673,678 probably benign Het
Lamc3 A G 2: 31,924,592 M1043V probably benign Het
Lgmn T C 12: 102,404,329 N114S possibly damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Notch4 A G 17: 34,578,097 T940A probably damaging Het
Nudt15 T A 14: 73,523,471 Q60L probably benign Het
Olfr1118 T C 2: 87,309,182 V151A probably benign Het
Olfr676 T C 7: 105,035,689 C164R probably benign Het
Phip G A 9: 82,876,126 R1505* probably null Het
Ptger2 T G 14: 44,989,327 S121R probably damaging Het
Scyl2 A T 10: 89,640,541 F907L probably damaging Het
Trpc4 C A 3: 54,318,012 F843L probably benign Het
Tysnd1 C T 10: 61,696,088 S173L possibly damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
R7599:Itgax UTSW 7 128148090 missense probably damaging 0.99
R7710:Itgax UTSW 7 128135856 missense probably benign 0.04
R7964:Itgax UTSW 7 128140418 critical splice acceptor site probably null
R8220:Itgax UTSW 7 128130918 missense probably benign 0.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Z1176:Itgax UTSW 7 128144872 missense probably benign 0.24
Z1177:Itgax UTSW 7 128148062 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGGGCCTCCTACAAGAAAG -3'
(R):5'- CAATTGGGTCACAGGTTCCCAG -3'

Sequencing Primer
(F):5'- ATCCCCATTTTTACAGTCAGCAGAAG -3'
(R):5'- TCACAGGTTCCCAGGCTGAAG -3'
Posted On2015-04-06