Mutagenetix > Incidental Mutations

Incidental Mutation 'R3846:Itgax'

277372

Institutional Source

Beutler Lab

Gene Symbol

Itgax

Ensembl Gene

ENSMUSG00000030789

Gene Name

integrin alpha X

Synonyms

Cd11c, CD11C (p150) alpha polypeptide

MMRRC Submission

040894-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R3846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128129547-128150657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 128133767 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 273 (V273F)

Ref Sequence

ENSEMBL: ENSMUSP00000033053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000205460]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033053
AA Change: V273F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: V273F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Int_alpha	33	83	1.28e1	SMART
VWA	150	331	8.36e-43	SMART
Int_alpha	402	451	3.67e-3	SMART
Int_alpha	455	512	1.29e-7	SMART
Int_alpha	518	574	5.72e-14	SMART
Int_alpha	581	635	1.55e-1	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	6.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205408

Predicted Effect

probably benign
Transcript: ENSMUST00000205460

Meta Mutation Damage Score

0.5313

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	A	G	2: 35,354,558	Y261H	probably damaging	Het
Acad10	T	A	5: 121,634,686	I511F	probably benign	Het
Adgb	G	A	10: 10,382,721		probably benign	Het
Adgrg3	T	C	8: 95,040,421	V468A	probably benign	Het
Ano4	A	T	10: 88,995,252	I468N	possibly damaging	Het
Apool	A	T	X: 112,364,458		probably benign	Het
Arhgap32	T	C	9: 32,190,024	V295A	probably benign	Het
Ccser2	A	G	14: 36,940,288	V313A	probably benign	Het
Ctnnd1	T	C	2: 84,616,927	I325V	probably benign	Het
Cubn	T	C	2: 13,283,008	D3420G	probably damaging	Het
Dnah12	A	G	14: 26,710,211	T395A	probably benign	Het
Dock2	T	G	11: 34,732,371	H65P	possibly damaging	Het
Fsip2	A	T	2: 82,986,415	Q4164L	possibly damaging	Het
Gapvd1	A	T	2: 34,729,072	Y96*	probably null	Het
Gja3	T	A	14: 57,035,704	K404*	probably null	Het
Gm10093	A	G	17: 78,492,972	K464R	possibly damaging	Het
Gm9866	T	A	12: 27,160,302		noncoding transcript	Het
Hmcn2	A	G	2: 31,430,350	I3948V	possibly damaging	Het
Hr	C	T	14: 70,571,453	R1090W	probably damaging	Het
Hrnr	A	G	3: 93,332,157	H3234R	unknown	Het
Ifi207	T	A	1: 173,735,303	E92D	probably benign	Het
Iqgap2	G	A	13: 95,673,678		probably benign	Het
Lamc3	A	G	2: 31,924,592	M1043V	probably benign	Het
Lgmn	T	C	12: 102,404,329	N114S	possibly damaging	Het
Mov10l1	A	G	15: 89,012,142	N678D	possibly damaging	Het
Nlrp9c	A	G	7: 26,382,276		probably null	Het
Notch4	A	G	17: 34,578,097	T940A	probably damaging	Het
Nudt15	T	A	14: 73,523,471	Q60L	probably benign	Het
Olfr1118	T	C	2: 87,309,182	V151A	probably benign	Het
Olfr676	T	C	7: 105,035,689	C164R	probably benign	Het
Phip	G	A	9: 82,876,126	R1505*	probably null	Het
Ptger2	T	G	14: 44,989,327	S121R	probably damaging	Het
Scyl2	A	T	10: 89,640,541	F907L	probably damaging	Het
Trpc4	C	A	3: 54,318,012	F843L	probably benign	Het
Tysnd1	C	T	10: 61,696,088	S173L	possibly damaging	Het
Vmn2r124	T	A	17: 18,073,691	V680D	possibly damaging	Het
Vmn2r91	G	A	17: 18,107,598	V485I	probably benign	Het

Other mutations in Itgax

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Itgax	APN	7	128135326	missense	probably damaging	1.00
IGL00325:Itgax	APN	7	128148309	missense	possibly damaging	0.69
IGL01155:Itgax	APN	7	128145035	missense	probably benign	0.00
IGL01461:Itgax	APN	7	128135018	missense	probably damaging	1.00
IGL01508:Itgax	APN	7	128144818	missense	probably damaging	1.00
IGL01549:Itgax	APN	7	128131206	splice site	probably null
IGL01864:Itgax	APN	7	128133763	missense	probably benign	0.00
IGL02094:Itgax	APN	7	128131473	missense	probably damaging	1.00
IGL02364:Itgax	APN	7	128139982	missense	possibly damaging	0.89
IGL02969:Itgax	APN	7	128149123	missense	probably benign
IGL03406:Itgax	APN	7	128149198	missense	possibly damaging	0.93
Adendritic	UTSW	7	128148572	nonsense	probably null
PIT4651001:Itgax	UTSW	7	128149110	missense	probably benign	0.11
R0366:Itgax	UTSW	7	128149089	splice site	probably benign
R0763:Itgax	UTSW	7	128147940	splice site	probably benign
R1072:Itgax	UTSW	7	128150144	missense	probably damaging	0.96
R1659:Itgax	UTSW	7	128130891	missense	probably benign	0.15
R2019:Itgax	UTSW	7	128148526	missense	probably benign
R2418:Itgax	UTSW	7	128142333	missense	probably damaging	0.98
R3027:Itgax	UTSW	7	128148572	nonsense	probably null
R3938:Itgax	UTSW	7	128136273	missense	possibly damaging	0.73
R4021:Itgax	UTSW	7	128133139	critical splice donor site	probably null
R4027:Itgax	UTSW	7	128141266	missense	possibly damaging	0.75
R4163:Itgax	UTSW	7	128144700	missense	probably benign	0.00
R4923:Itgax	UTSW	7	128148528	missense	probably benign
R5259:Itgax	UTSW	7	128148278	missense	probably damaging	0.99
R5333:Itgax	UTSW	7	128142283	missense	probably damaging	1.00
R5347:Itgax	UTSW	7	128141302	missense	probably benign	0.08
R5679:Itgax	UTSW	7	128134990	missense	probably benign	0.00
R5725:Itgax	UTSW	7	128147861	missense	possibly damaging	0.63
R5733:Itgax	UTSW	7	128140475	missense	probably damaging	0.99
R5750:Itgax	UTSW	7	128144706	missense	probably benign	0.32
R5964:Itgax	UTSW	7	128140447	missense	probably damaging	1.00
R6004:Itgax	UTSW	7	128131452	missense	probably damaging	0.96
R6168:Itgax	UTSW	7	128133097	missense	probably damaging	0.99
R6212:Itgax	UTSW	7	128130332	missense	possibly damaging	0.52
R6212:Itgax	UTSW	7	128147853	missense	probably benign	0.16
R6480:Itgax	UTSW	7	128148599	missense	probably benign	0.12
R6484:Itgax	UTSW	7	128133718	missense	probably benign	0.13
R6796:Itgax	UTSW	7	128135064	missense	probably damaging	1.00
R6844:Itgax	UTSW	7	128147934	splice site	probably null
R7287:Itgax	UTSW	7	128148505	missense	probably damaging	1.00
R7365:Itgax	UTSW	7	128135309	missense	probably damaging	1.00
R7421:Itgax	UTSW	7	128140432	missense	probably damaging	1.00
R7599:Itgax	UTSW	7	128148090	missense	probably damaging	0.99
R7710:Itgax	UTSW	7	128135856	missense	probably benign	0.04
R7964:Itgax	UTSW	7	128140418	critical splice acceptor site	probably null
R8220:Itgax	UTSW	7	128130918	missense	probably benign	0.00
X0061:Itgax	UTSW	7	128129607	start gained	probably benign
Z1176:Itgax	UTSW	7	128144872	missense	probably benign	0.24
Z1177:Itgax	UTSW	7	128148062	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGGGGCCTCCTACAAGAAAG -3'
(R):5'- CAATTGGGTCACAGGTTCCCAG -3'

Sequencing Primer
(F):5'- ATCCCCATTTTTACAGTCAGCAGAAG -3'
(R):5'- TCACAGGTTCCCAGGCTGAAG -3'

Posted On

2015-04-06