Incidental Mutation 'R3846:Lgmn'
ID277382
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Namelegumain
SynonymsPrsc1, preprolegumain, AEP
MMRRC Submission 040894-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3846 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102394084-102439813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102404329 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 114 (N114S)
Ref Sequence ENSEMBL: ENSMUSP00000105647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000110020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021607
AA Change: N114S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190
AA Change: N114S

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110020
AA Change: N114S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190
AA Change: N114S

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146499
Meta Mutation Damage Score 0.6313 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,354,558 Y261H probably damaging Het
Acad10 T A 5: 121,634,686 I511F probably benign Het
Adgb G A 10: 10,382,721 probably benign Het
Adgrg3 T C 8: 95,040,421 V468A probably benign Het
Ano4 A T 10: 88,995,252 I468N possibly damaging Het
Apool A T X: 112,364,458 probably benign Het
Arhgap32 T C 9: 32,190,024 V295A probably benign Het
Ccser2 A G 14: 36,940,288 V313A probably benign Het
Ctnnd1 T C 2: 84,616,927 I325V probably benign Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Dnah12 A G 14: 26,710,211 T395A probably benign Het
Dock2 T G 11: 34,732,371 H65P possibly damaging Het
Fsip2 A T 2: 82,986,415 Q4164L possibly damaging Het
Gapvd1 A T 2: 34,729,072 Y96* probably null Het
Gja3 T A 14: 57,035,704 K404* probably null Het
Gm10093 A G 17: 78,492,972 K464R possibly damaging Het
Gm9866 T A 12: 27,160,302 noncoding transcript Het
Hmcn2 A G 2: 31,430,350 I3948V possibly damaging Het
Hr C T 14: 70,571,453 R1090W probably damaging Het
Hrnr A G 3: 93,332,157 H3234R unknown Het
Ifi207 T A 1: 173,735,303 E92D probably benign Het
Iqgap2 G A 13: 95,673,678 probably benign Het
Itgax G T 7: 128,133,767 V273F probably damaging Het
Lamc3 A G 2: 31,924,592 M1043V probably benign Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Notch4 A G 17: 34,578,097 T940A probably damaging Het
Nudt15 T A 14: 73,523,471 Q60L probably benign Het
Olfr1118 T C 2: 87,309,182 V151A probably benign Het
Olfr676 T C 7: 105,035,689 C164R probably benign Het
Phip G A 9: 82,876,126 R1505* probably null Het
Ptger2 T G 14: 44,989,327 S121R probably damaging Het
Scyl2 A T 10: 89,640,541 F907L probably damaging Het
Trpc4 C A 3: 54,318,012 F843L probably benign Het
Tysnd1 C T 10: 61,696,088 S173L possibly damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0988:Lgmn UTSW 12 102398277 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R1972:Lgmn UTSW 12 102395821 unclassified probably benign
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R5969:Lgmn UTSW 12 102405827 missense probably damaging 1.00
R6090:Lgmn UTSW 12 102400154 missense probably damaging 1.00
R6420:Lgmn UTSW 12 102423719 nonsense probably null
R6496:Lgmn UTSW 12 102398239 missense probably benign 0.01
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCAAGGAAACAGGTGCG -3'
(R):5'- GACTGTCCTTTATTCCATAGTGGTG -3'

Sequencing Primer
(F):5'- CCAAGGAAACAGGTGCGAACAG -3'
(R):5'- AAAGCTTGCTGAGTTGCCAC -3'
Posted On2015-04-06