Mutagenetix > Incidental Mutation

Incidental Mutation 'R3846:Iqgap2'

277383

Institutional Source

Beutler Lab

Gene Symbol

Iqgap2

Ensembl Gene

ENSMUSG00000021676

Gene Name

IQ motif containing GTPase activating protein 2

Synonyms

4933417J23Rik

MMRRC Submission

040894-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95627177-95891922 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 95673678 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000067685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068603]

AlphaFold

Q3UQ44

Predicted Effect

probably benign
Transcript: ENSMUST00000068603

SMART Domains

Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

Domain	Start	End	E-Value	Type
CH	43	152	3.32e-16	SMART
coiled coil region	253	276	N/A	INTRINSIC
low complexity region	469	480	N/A	INTRINSIC
IQ	689	711	1.38e-4	SMART
IQ	719	741	7.36e0	SMART
IQ	749	771	2.43e1	SMART
coiled coil region	799	828	N/A	INTRINSIC
RasGAP	905	1258	2.6e-120	SMART
Pfam:RasGAP_C	1367	1498	3.2e-40	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	A	G	2: 35,354,558	Y261H	probably damaging	Het
Acad10	T	A	5: 121,634,686	I511F	probably benign	Het
Adgb	G	A	10: 10,382,721		probably benign	Het
Adgrg3	T	C	8: 95,040,421	V468A	probably benign	Het
Ano4	A	T	10: 88,995,252	I468N	possibly damaging	Het
Apool	A	T	X: 112,364,458		probably benign	Het
Arhgap32	T	C	9: 32,190,024	V295A	probably benign	Het
Ccser2	A	G	14: 36,940,288	V313A	probably benign	Het
Ctnnd1	T	C	2: 84,616,927	I325V	probably benign	Het
Cubn	T	C	2: 13,283,008	D3420G	probably damaging	Het
Dnah12	A	G	14: 26,710,211	T395A	probably benign	Het
Dock2	T	G	11: 34,732,371	H65P	possibly damaging	Het
Fsip2	A	T	2: 82,986,415	Q4164L	possibly damaging	Het
Gapvd1	A	T	2: 34,729,072	Y96*	probably null	Het
Gja3	T	A	14: 57,035,704	K404*	probably null	Het
Gm10093	A	G	17: 78,492,972	K464R	possibly damaging	Het
Gm9866	T	A	12: 27,160,302		noncoding transcript	Het
Hmcn2	A	G	2: 31,430,350	I3948V	possibly damaging	Het
Hr	C	T	14: 70,571,453	R1090W	probably damaging	Het
Hrnr	A	G	3: 93,332,157	H3234R	unknown	Het
Ifi207	T	A	1: 173,735,303	E92D	probably benign	Het
Itgax	G	T	7: 128,133,767	V273F	probably damaging	Het
Lamc3	A	G	2: 31,924,592	M1043V	probably benign	Het
Lgmn	T	C	12: 102,404,329	N114S	possibly damaging	Het
Mov10l1	A	G	15: 89,012,142	N678D	possibly damaging	Het
Nlrp9c	A	G	7: 26,382,276		probably null	Het
Notch4	A	G	17: 34,578,097	T940A	probably damaging	Het
Nudt15	T	A	14: 73,523,471	Q60L	probably benign	Het
Olfr1118	T	C	2: 87,309,182	V151A	probably benign	Het
Olfr676	T	C	7: 105,035,689	C164R	probably benign	Het
Phip	G	A	9: 82,876,126	R1505*	probably null	Het
Ptger2	T	G	14: 44,989,327	S121R	probably damaging	Het
Scyl2	A	T	10: 89,640,541	F907L	probably damaging	Het
Trpc4	C	A	3: 54,318,012	F843L	probably benign	Het
Tysnd1	C	T	10: 61,696,088	S173L	possibly damaging	Het
Vmn2r124	T	A	17: 18,073,691	V680D	possibly damaging	Het
Vmn2r91	G	A	17: 18,107,598	V485I	probably benign	Het

Other mutations in Iqgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Iqgap2	APN	13	95657944	splice site	probably benign
IGL01968:Iqgap2	APN	13	95635582	missense	possibly damaging	0.80
IGL02049:Iqgap2	APN	13	95675405	splice site	probably benign
IGL02195:Iqgap2	APN	13	95661734	splice site	probably benign
IGL02387:Iqgap2	APN	13	95689701	missense	probably benign	0.00
IGL02634:Iqgap2	APN	13	95628114	missense	probably damaging	1.00
IGL02666:Iqgap2	APN	13	95628056	missense	probably damaging	1.00
IGL02685:Iqgap2	APN	13	95671404	missense	probably damaging	1.00
IGL02927:Iqgap2	APN	13	95724676	missense	possibly damaging	0.62
IGL02943:Iqgap2	APN	13	95661735	splice site	probably benign
IGL03167:Iqgap2	APN	13	95684898	missense	probably benign	0.34
IGL03169:Iqgap2	APN	13	95731277	splice site	probably null
IGL03293:Iqgap2	APN	13	95731434	missense	probably damaging	1.00
G1Funyon:Iqgap2	UTSW	13	95682151	critical splice donor site	probably null
R0257:Iqgap2	UTSW	13	95724544	critical splice donor site	probably null
R0335:Iqgap2	UTSW	13	95635633	missense	probably damaging	0.99
R0360:Iqgap2	UTSW	13	95731275	splice site	probably benign
R0364:Iqgap2	UTSW	13	95731275	splice site	probably benign
R0419:Iqgap2	UTSW	13	95689699	critical splice donor site	probably null
R1229:Iqgap2	UTSW	13	95632165	missense	probably benign	0.32
R1290:Iqgap2	UTSW	13	95668513	missense	probably damaging	1.00
R1397:Iqgap2	UTSW	13	95632165	missense	probably benign	0.32
R1498:Iqgap2	UTSW	13	95646805	missense	probably benign
R1513:Iqgap2	UTSW	13	95630010	missense	probably damaging	1.00
R1630:Iqgap2	UTSW	13	95689785	missense	probably benign
R2088:Iqgap2	UTSW	13	95891663	critical splice donor site	probably null
R2928:Iqgap2	UTSW	13	95682236	missense	probably benign
R3026:Iqgap2	UTSW	13	95673056	critical splice acceptor site	probably null
R3720:Iqgap2	UTSW	13	95668528	splice site	probably null
R4056:Iqgap2	UTSW	13	95750033	missense	probably damaging	1.00
R4077:Iqgap2	UTSW	13	95657867	missense	probably damaging	1.00
R4353:Iqgap2	UTSW	13	95671396	missense	probably damaging	1.00
R4517:Iqgap2	UTSW	13	95664061	critical splice donor site	probably null
R4628:Iqgap2	UTSW	13	95763329	missense	probably benign	0.17
R4686:Iqgap2	UTSW	13	95721609	missense	probably damaging	0.98
R4724:Iqgap2	UTSW	13	95635497	missense	possibly damaging	0.73
R4826:Iqgap2	UTSW	13	95763275	missense	probably damaging	1.00
R4847:Iqgap2	UTSW	13	95673743	missense	probably benign	0.19
R4967:Iqgap2	UTSW	13	95630006	missense	probably benign	0.00
R4973:Iqgap2	UTSW	13	95657797	splice site	probably null
R5010:Iqgap2	UTSW	13	95673743	missense	probably benign	0.19
R5086:Iqgap2	UTSW	13	95635580	missense	probably benign	0.01
R5496:Iqgap2	UTSW	13	95630053	missense	probably damaging	1.00
R5512:Iqgap2	UTSW	13	95675376	nonsense	probably null
R5629:Iqgap2	UTSW	13	95632174	missense	probably damaging	1.00
R5824:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5830:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5831:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5832:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5833:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5834:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5852:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5888:Iqgap2	UTSW	13	95635610	missense	possibly damaging	0.89
R5889:Iqgap2	UTSW	13	95632042	missense	probably benign	0.00
R6093:Iqgap2	UTSW	13	95628963	missense	probably damaging	0.99
R6141:Iqgap2	UTSW	13	95721686	splice site	probably null
R6404:Iqgap2	UTSW	13	95729477	missense	probably benign	0.28
R6434:Iqgap2	UTSW	13	95682933	missense	possibly damaging	0.85
R6648:Iqgap2	UTSW	13	95682211	missense	probably benign	0.27
R6658:Iqgap2	UTSW	13	95660332	missense	probably damaging	1.00
R6903:Iqgap2	UTSW	13	95661057	missense	probably damaging	1.00
R7223:Iqgap2	UTSW	13	95628972	missense	probably damaging	1.00
R7327:Iqgap2	UTSW	13	95635655	missense	probably benign	0.00
R7371:Iqgap2	UTSW	13	95700338	splice site	probably null
R7378:Iqgap2	UTSW	13	95732890	critical splice donor site	probably null
R7441:Iqgap2	UTSW	13	95628076	missense	probably benign	0.23
R7575:Iqgap2	UTSW	13	95661623	missense	probably damaging	0.99
R7671:Iqgap2	UTSW	13	95628119	missense	probably damaging	0.98
R7713:Iqgap2	UTSW	13	95731444	missense	probably benign	0.01
R7806:Iqgap2	UTSW	13	95682257	missense	probably benign	0.00
R7893:Iqgap2	UTSW	13	95689709	missense	probably damaging	0.96
R8052:Iqgap2	UTSW	13	95657879	missense	probably damaging	0.96
R8121:Iqgap2	UTSW	13	95724568	missense	probably benign	0.00
R8261:Iqgap2	UTSW	13	95635570	missense	probably damaging	1.00
R8301:Iqgap2	UTSW	13	95682151	critical splice donor site	probably null
R8369:Iqgap2	UTSW	13	95661603	missense	probably damaging	1.00
R8485:Iqgap2	UTSW	13	95660151	missense	probably damaging	0.99
R8709:Iqgap2	UTSW	13	95660205	missense	probably damaging	0.99
R8710:Iqgap2	UTSW	13	95660248	missense	probably benign	0.24
R8737:Iqgap2	UTSW	13	95665750	missense	probably damaging	1.00
R8845:Iqgap2	UTSW	13	95657884	missense	possibly damaging	0.60
R8902:Iqgap2	UTSW	13	95682203	missense	probably benign	0.16
R8957:Iqgap2	UTSW	13	95635646	missense	probably damaging	1.00
R9153:Iqgap2	UTSW	13	95708039	missense	probably benign
R9259:Iqgap2	UTSW	13	95630053	missense	probably damaging	1.00
R9290:Iqgap2	UTSW	13	95750015	missense	probably damaging	1.00
R9414:Iqgap2	UTSW	13	95646841	missense
R9432:Iqgap2	UTSW	13	95637753	missense	probably benign
R9747:Iqgap2	UTSW	13	95684997	missense	probably damaging	1.00
X0066:Iqgap2	UTSW	13	95671383	missense	probably damaging	0.98
Z1176:Iqgap2	UTSW	13	95731443	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTGGCATTACTAGCCCAGGC -3'
(R):5'- AGGCAATGCAAGGCTGTTCAG -3'

Sequencing Primer
(F):5'- CCTGACTCTGTGTGACTTCTGAG -3'
(R):5'- TCAGCAGATAATAGTCTTAGGAAGGC -3'

Posted On

2015-04-06