Incidental Mutation 'R3846:Ptger2'
ID 277388
Institutional Source Beutler Lab
Gene Symbol Ptger2
Ensembl Gene ENSMUSG00000037759
Gene Name prostaglandin E receptor 2 (subtype EP2)
Synonyms EP2, EP2 receptor, Ptgerep2
MMRRC Submission 040894-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3846 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 45225652-45241277 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 45226784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 121 (S121R)
Ref Sequence ENSEMBL: ENSMUSP00000038483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046891]
AlphaFold Q62053
Predicted Effect probably damaging
Transcript: ENSMUST00000046891
AA Change: S121R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038483
Gene: ENSMUSG00000037759
AA Change: S121R

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Pfam:7tm_1 57 315 5e-26 PFAM
Pfam:7TM_GPCR_Srx 65 243 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 66 319 1.2e-7 PFAM
low complexity region 338 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228945
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for one targeted null mutation exhibit increased blood pressure when fed a high-salt diet. Female mutants for 2 null alleles have small litters due to impaired ovulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,244,570 (GRCm39) Y261H probably damaging Het
Acad10 T A 5: 121,772,749 (GRCm39) I511F probably benign Het
Adgb G A 10: 10,258,465 (GRCm39) probably benign Het
Adgrg3 T C 8: 95,767,049 (GRCm39) V468A probably benign Het
Ano4 A T 10: 88,831,114 (GRCm39) I468N possibly damaging Het
Apool A T X: 111,274,155 (GRCm39) probably benign Het
Arhgap32 T C 9: 32,101,320 (GRCm39) V295A probably benign Het
Ccser2 A G 14: 36,662,245 (GRCm39) V313A probably benign Het
Ctnnd1 T C 2: 84,447,271 (GRCm39) I325V probably benign Het
Cubn T C 2: 13,287,819 (GRCm39) D3420G probably damaging Het
Dnah12 A G 14: 26,431,366 (GRCm39) T395A probably benign Het
Dock2 T G 11: 34,623,198 (GRCm39) H65P possibly damaging Het
Fsip2 A T 2: 82,816,759 (GRCm39) Q4164L possibly damaging Het
Gapvd1 A T 2: 34,619,084 (GRCm39) Y96* probably null Het
Gja3 T A 14: 57,273,161 (GRCm39) K404* probably null Het
Hdac1-ps A G 17: 78,800,401 (GRCm39) K464R possibly damaging Het
Hmcn2 A G 2: 31,320,362 (GRCm39) I3948V possibly damaging Het
Hr C T 14: 70,808,893 (GRCm39) R1090W probably damaging Het
Hrnr A G 3: 93,239,464 (GRCm39) H3234R unknown Het
Ifi207 T A 1: 173,562,869 (GRCm39) E92D probably benign Het
Iqgap2 G A 13: 95,810,186 (GRCm39) probably benign Het
Itgax G T 7: 127,732,939 (GRCm39) V273F probably damaging Het
Lamc3 A G 2: 31,814,604 (GRCm39) M1043V probably benign Het
Lgmn T C 12: 102,370,588 (GRCm39) N114S possibly damaging Het
Mov10l1 A G 15: 88,896,345 (GRCm39) N678D possibly damaging Het
Nlrp9c A G 7: 26,081,701 (GRCm39) probably null Het
Notch4 A G 17: 34,797,071 (GRCm39) T940A probably damaging Het
Nudt15 T A 14: 73,760,911 (GRCm39) Q60L probably benign Het
Or10ag56 T C 2: 87,139,526 (GRCm39) V151A probably benign Het
Or52e7 T C 7: 104,684,896 (GRCm39) C164R probably benign Het
Phip G A 9: 82,758,179 (GRCm39) R1505* probably null Het
Scyl2 A T 10: 89,476,403 (GRCm39) F907L probably damaging Het
Silc1 T A 12: 27,210,301 (GRCm39) noncoding transcript Het
Trpc4 C A 3: 54,225,433 (GRCm39) F843L probably benign Het
Tysnd1 C T 10: 61,531,867 (GRCm39) S173L possibly damaging Het
Vmn2r124 T A 17: 18,293,953 (GRCm39) V680D possibly damaging Het
Vmn2r91 G A 17: 18,327,860 (GRCm39) V485I probably benign Het
Other mutations in Ptger2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ptger2 APN 14 45,239,198 (GRCm39) splice site probably benign
IGL03127:Ptger2 APN 14 45,239,462 (GRCm39) utr 3 prime probably benign
R0533:Ptger2 UTSW 14 45,226,439 (GRCm39) missense possibly damaging 0.90
R0720:Ptger2 UTSW 14 45,226,590 (GRCm39) missense probably benign
R0973:Ptger2 UTSW 14 45,226,957 (GRCm39) missense probably damaging 1.00
R1643:Ptger2 UTSW 14 45,226,423 (GRCm39) start codon destroyed probably null 0.98
R1737:Ptger2 UTSW 14 45,239,228 (GRCm39) missense probably benign 0.04
R2281:Ptger2 UTSW 14 45,227,107 (GRCm39) missense probably damaging 1.00
R4623:Ptger2 UTSW 14 45,226,471 (GRCm39) missense possibly damaging 0.91
R4735:Ptger2 UTSW 14 45,239,295 (GRCm39) missense possibly damaging 0.89
R5001:Ptger2 UTSW 14 45,226,824 (GRCm39) missense probably damaging 1.00
R5438:Ptger2 UTSW 14 45,227,101 (GRCm39) missense possibly damaging 0.47
R5613:Ptger2 UTSW 14 45,226,960 (GRCm39) missense possibly damaging 0.88
R5767:Ptger2 UTSW 14 45,226,599 (GRCm39) missense probably benign 0.01
R7405:Ptger2 UTSW 14 45,226,531 (GRCm39) missense probably damaging 1.00
R9165:Ptger2 UTSW 14 45,227,235 (GRCm39) missense probably damaging 1.00
R9729:Ptger2 UTSW 14 45,226,476 (GRCm39) missense possibly damaging 0.73
Z1177:Ptger2 UTSW 14 45,226,478 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCAGGACCTCTATCTCCTTG -3'
(R):5'- TGAAGGTATGCAGTCCTCCC -3'

Sequencing Primer
(F):5'- CCTTGTTTCACGTGCTGGTAACG -3'
(R):5'- TACTGGACGTACTCCCCGTAG -3'
Posted On 2015-04-06