Incidental Mutation 'R3846:Gja3'
ID277389
Institutional Source Beutler Lab
Gene Symbol Gja3
Ensembl Gene ENSMUSG00000048582
Gene Namegap junction protein, alpha 3
SynonymsCx46, Gja-3, connexin 46, alpha 3 connexin
MMRRC Submission 040894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3846 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57034460-57058100 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57035704 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 404 (K404*)
Ref Sequence ENSEMBL: ENSMUSP00000059587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061614] [ENSMUST00000223792]
Predicted Effect probably null
Transcript: ENSMUST00000061614
AA Change: K404*
SMART Domains Protein: ENSMUSP00000059587
Gene: ENSMUSG00000048582
AA Change: K404*

DomainStartEndE-ValueType
CNX 43 76 4.4e-21 SMART
low complexity region 103 116 N/A INTRINSIC
Connexin_CCC 165 231 3.36e-44 SMART
low complexity region 342 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223792
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a connexin and is a component of lens fiber gap junctions. Defects in this gene are a cause of zonular pulverulent cataract type 3 (CZP3). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutants exhibit lens nuclear cataracts associated with breakdown of gamma crystallin. Severity of the defect is influenced by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A G 2: 35,354,558 Y261H probably damaging Het
Acad10 T A 5: 121,634,686 I511F probably benign Het
Adgb G A 10: 10,382,721 probably benign Het
Adgrg3 T C 8: 95,040,421 V468A probably benign Het
Ano4 A T 10: 88,995,252 I468N possibly damaging Het
Apool A T X: 112,364,458 probably benign Het
Arhgap32 T C 9: 32,190,024 V295A probably benign Het
Ccser2 A G 14: 36,940,288 V313A probably benign Het
Ctnnd1 T C 2: 84,616,927 I325V probably benign Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Dnah12 A G 14: 26,710,211 T395A probably benign Het
Dock2 T G 11: 34,732,371 H65P possibly damaging Het
Fsip2 A T 2: 82,986,415 Q4164L possibly damaging Het
Gapvd1 A T 2: 34,729,072 Y96* probably null Het
Gm10093 A G 17: 78,492,972 K464R possibly damaging Het
Gm9866 T A 12: 27,160,302 noncoding transcript Het
Hmcn2 A G 2: 31,430,350 I3948V possibly damaging Het
Hr C T 14: 70,571,453 R1090W probably damaging Het
Hrnr A G 3: 93,332,157 H3234R unknown Het
Ifi207 T A 1: 173,735,303 E92D probably benign Het
Iqgap2 G A 13: 95,673,678 probably benign Het
Itgax G T 7: 128,133,767 V273F probably damaging Het
Lamc3 A G 2: 31,924,592 M1043V probably benign Het
Lgmn T C 12: 102,404,329 N114S possibly damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Notch4 A G 17: 34,578,097 T940A probably damaging Het
Nudt15 T A 14: 73,523,471 Q60L probably benign Het
Olfr1118 T C 2: 87,309,182 V151A probably benign Het
Olfr676 T C 7: 105,035,689 C164R probably benign Het
Phip G A 9: 82,876,126 R1505* probably null Het
Ptger2 T G 14: 44,989,327 S121R probably damaging Het
Scyl2 A T 10: 89,640,541 F907L probably damaging Het
Trpc4 C A 3: 54,318,012 F843L probably benign Het
Tysnd1 C T 10: 61,696,088 S173L possibly damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Other mutations in Gja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Gja3 APN 14 57035679 missense probably damaging 1.00
R0470:Gja3 UTSW 14 57036427 missense probably damaging 1.00
R0631:Gja3 UTSW 14 57036762 missense possibly damaging 0.95
R1455:Gja3 UTSW 14 57036385 missense probably damaging 1.00
R1687:Gja3 UTSW 14 57036876 missense probably damaging 0.99
R2229:Gja3 UTSW 14 57036714 missense probably damaging 1.00
R5337:Gja3 UTSW 14 57035832 missense probably benign 0.22
R5797:Gja3 UTSW 14 57035713 missense probably damaging 0.98
R5940:Gja3 UTSW 14 57035860 missense probably damaging 0.99
R7226:Gja3 UTSW 14 57035893 missense probably benign 0.01
R8066:Gja3 UTSW 14 57035806 missense probably benign 0.00
Z1088:Gja3 UTSW 14 57035815 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TAAAACCAGACTGATCCAGTTTGC -3'
(R):5'- AAGCCCTCTTCAGCAGCATC -3'

Sequencing Primer
(F):5'- CAGACTGATCCAGTTTGCTCAGTG -3'
(R):5'- GCATCCAGCCCTGATGG -3'
Posted On2015-04-06