Mutagenetix > Incidental Mutations

Incidental Mutation 'R3847:Col3a1'

277400

Institutional Source

Beutler Lab

Gene Symbol

Col3a1

Ensembl Gene

ENSMUSG00000026043

Gene Name

collagen, type III, alpha 1

Synonyms

Col3a-1

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.861) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45311538-45349706 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 45321990 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 112 (P112T)

Ref Sequence

ENSEMBL: ENSMUSP00000085192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087883]

Predicted Effect

unknown
Transcript: ENSMUST00000087883
AA Change: P112T

SMART Domains

Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: P112T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWC	33	89	2.73e-20	SMART
low complexity region	100	140	N/A	INTRINSIC
low complexity region	163	227	N/A	INTRINSIC
low complexity region	230	248	N/A	INTRINSIC
internal_repeat_2	249	284	3.45e-13	PROSPERO
internal_repeat_1	250	290	1.9e-17	PROSPERO
Pfam:Collagen	293	366	7.3e-9	PFAM
low complexity region	368	419	N/A	INTRINSIC
internal_repeat_4	423	476	2.52e-11	PROSPERO
internal_repeat_1	427	488	1.9e-17	PROSPERO
internal_repeat_3	427	491	7.39e-12	PROSPERO
internal_repeat_2	456	491	3.45e-13	PROSPERO
Pfam:Collagen	533	592	2.6e-11	PFAM
low complexity region	632	680	N/A	INTRINSIC
low complexity region	683	776	N/A	INTRINSIC
low complexity region	784	815	N/A	INTRINSIC
low complexity region	818	855	N/A	INTRINSIC
low complexity region	865	921	N/A	INTRINSIC
low complexity region	925	950	N/A	INTRINSIC
low complexity region	953	974	N/A	INTRINSIC
internal_repeat_4	975	1028	2.52e-11	PROSPERO
internal_repeat_3	976	1029	7.39e-12	PROSPERO
internal_repeat_5	977	991	3.33e-5	PROSPERO
internal_repeat_5	1019	1033	3.33e-5	PROSPERO
low complexity region	1037	1058	N/A	INTRINSIC
Pfam:Collagen	1076	1135	5.6e-13	PFAM
Pfam:Collagen	1136	1209	4.3e-11	PFAM
COLFI	1229	1464	5.73e-166	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129611

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189818

Meta Mutation Damage Score

0.0827

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Col3a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Col3a1	APN	1	45347135	missense	probably damaging	1.00
IGL00928:Col3a1	APN	1	45340858	intron	probably benign
IGL00958:Col3a1	APN	1	45327595	missense	unknown
IGL01353:Col3a1	APN	1	45333638	unclassified	probably benign
IGL01820:Col3a1	APN	1	45321608	missense	unknown
IGL01839:Col3a1	APN	1	45311830	missense	unknown
IGL02517:Col3a1	APN	1	45325803	critical splice acceptor site	probably null
IGL02879:Col3a1	APN	1	45340959	intron	probably benign
IGL02960:Col3a1	APN	1	45328455	missense	unknown
IGL03245:Col3a1	APN	1	45331109	unclassified	probably benign
IGL03308:Col3a1	APN	1	45330617	splice site	probably benign
Kraken	UTSW	1	45327866	splice site	probably null
IGL03050:Col3a1	UTSW	1	45328925	splice site	probably null
PIT4520001:Col3a1	UTSW	1	45335783	critical splice donor site	probably null
R0063:Col3a1	UTSW	1	45330541	splice site	probably benign
R0122:Col3a1	UTSW	1	45340897	intron	probably benign
R0131:Col3a1	UTSW	1	45328868	splice site	probably benign
R0762:Col3a1	UTSW	1	45321526	missense	unknown
R0765:Col3a1	UTSW	1	45336651	unclassified	probably benign
R0853:Col3a1	UTSW	1	45343324	intron	probably benign
R0898:Col3a1	UTSW	1	45333993	unclassified	probably benign
R1170:Col3a1	UTSW	1	45327601	missense	unknown
R1170:Col3a1	UTSW	1	45347724	missense	probably damaging	1.00
R1440:Col3a1	UTSW	1	45343312	splice site	probably null
R1449:Col3a1	UTSW	1	45321611	missense	unknown
R1526:Col3a1	UTSW	1	45321688	missense	unknown
R1572:Col3a1	UTSW	1	45345968	missense	possibly damaging	0.95
R1585:Col3a1	UTSW	1	45327866	splice site	probably null
R1616:Col3a1	UTSW	1	45328488	critical splice donor site	probably null
R1691:Col3a1	UTSW	1	45348616	unclassified	probably benign
R1876:Col3a1	UTSW	1	45342235	splice site	probably null
R1937:Col3a1	UTSW	1	45334293	unclassified	probably benign
R2093:Col3a1	UTSW	1	45332990	missense	probably damaging	1.00
R2110:Col3a1	UTSW	1	45330145	missense	unknown
R2119:Col3a1	UTSW	1	45346121	missense	probably damaging	1.00
R2256:Col3a1	UTSW	1	45321632	missense	unknown
R2327:Col3a1	UTSW	1	45338611	unclassified	probably benign
R2518:Col3a1	UTSW	1	45337512	unclassified	probably benign
R2991:Col3a1	UTSW	1	45335779	unclassified	probably benign
R3405:Col3a1	UTSW	1	45338753	unclassified	probably benign
R3784:Col3a1	UTSW	1	45347135	missense	probably damaging	1.00
R3848:Col3a1	UTSW	1	45321990	missense	unknown
R3849:Col3a1	UTSW	1	45321990	missense	unknown
R4502:Col3a1	UTSW	1	45348677	unclassified	probably benign
R4503:Col3a1	UTSW	1	45348677	unclassified	probably benign
R4764:Col3a1	UTSW	1	45346110	missense	probably damaging	1.00
R4839:Col3a1	UTSW	1	45323803	splice site	probably null
R4934:Col3a1	UTSW	1	45339952	unclassified	probably benign
R5033:Col3a1	UTSW	1	45346110	missense	probably damaging	1.00
R5123:Col3a1	UTSW	1	45333596	unclassified	probably benign
R5190:Col3a1	UTSW	1	45329084	missense	unknown
R5190:Col3a1	UTSW	1	45344807	intron	probably benign
R5375:Col3a1	UTSW	1	45347899	splice site	probably null
R5407:Col3a1	UTSW	1	45346052	missense	probably benign	0.03
R5627:Col3a1	UTSW	1	45331560	unclassified	probably benign
R5642:Col3a1	UTSW	1	45331712	unclassified	probably benign
R6014:Col3a1	UTSW	1	45321579	nonsense	probably null
R6052:Col3a1	UTSW	1	45345013	unclassified	probably benign
R6263:Col3a1	UTSW	1	45321575	missense	unknown
R6453:Col3a1	UTSW	1	45339378	unclassified	probably benign
R6463:Col3a1	UTSW	1	45342205	intron	probably benign
R6488:Col3a1	UTSW	1	45331534	unclassified	probably benign
R6525:Col3a1	UTSW	1	45347179	missense	possibly damaging	0.88
R6637:Col3a1	UTSW	1	45347730	missense	probably damaging	1.00
R6704:Col3a1	UTSW	1	45347732	missense	probably damaging	1.00
R6744:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6745:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6747:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6858:Col3a1	UTSW	1	45345984	missense	probably damaging	1.00
R6903:Col3a1	UTSW	1	45331988	missense	probably damaging	0.96
R7189:Col3a1	UTSW	1	45333657	missense	unknown
R7194:Col3a1	UTSW	1	45331700	missense	unknown
R7199:Col3a1	UTSW	1	45332141	missense	probably null	0.99
R7204:Col3a1	UTSW	1	45322418	missense	unknown
R7304:Col3a1	UTSW	1	45347811	missense	unknown
R7378:Col3a1	UTSW	1	45327647	splice site	probably null
R7398:Col3a1	UTSW	1	45327813	missense	unknown
R7742:Col3a1	UTSW	1	45345001	missense	unknown
R8072:Col3a1	UTSW	1	45321574	missense	unknown
R8177:Col3a1	UTSW	1	45335764	missense	unknown
R8183:Col3a1	UTSW	1	45334810	missense	unknown
R8445:Col3a1	UTSW	1	45341180	nonsense	probably null
R8490:Col3a1	UTSW	1	45345956	missense	probably benign	0.01
R8546:Col3a1	UTSW	1	45340939	intron	probably benign
R8720:Col3a1	UTSW	1	45347733	missense	unknown
Z1177:Col3a1	UTSW	1	45311800	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTACTGCATAGAGGTCTGAAAG -3'
(R):5'- TCAAACTTGGGAAAACTGAACC -3'

Sequencing Primer
(F):5'- GAAATGCAAGCCATGTCTGTTGC -3'
(R):5'- ACTTGGGAAAACTGAACCTTTAC -3'

Posted On

2015-04-06