Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Zbtb41'

277403

Institutional Source

Beutler Lab

Gene Symbol

Zbtb41

Ensembl Gene

ENSMUSG00000033964

Gene Name

zinc finger and BTB domain containing 41

Synonyms

9830132G07Rik, 8430415N23Rik

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.247) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139422288-139453005 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139423996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 282 (H282Q)

Ref Sequence

ENSEMBL: ENSMUSP00000142797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]

AlphaFold

Q811F1

Predicted Effect

probably benign
Transcript: ENSMUST00000039867
AA Change: H282Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: H282Q

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	7.06e-16	SMART
ZnF_C2H2	208	231	3.78e-1	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	4.17e-3	SMART
ZnF_C2H2	388	410	8.34e-3	SMART
ZnF_C2H2	421	444	2.67e-1	SMART
ZnF_C2H2	462	484	1.72e-4	SMART
ZnF_C2H2	490	513	1.41e0	SMART
ZnF_C2H2	517	540	1.12e-3	SMART
ZnF_C2H2	546	568	1.36e-2	SMART
ZnF_C2H2	574	596	2.91e-2	SMART
ZnF_C2H2	602	624	7.37e-4	SMART
ZnF_C2H2	630	653	3.39e-3	SMART
ZnF_C2H2	667	689	2.75e-3	SMART
ZnF_C2H2	695	717	3.16e-3	SMART
ZnF_C2H2	723	746	3.34e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000199011
AA Change: H114Q

Predicted Effect

probably benign
Transcript: ENSMUST00000200243
AA Change: H282Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: H282Q

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	4.7e-18	SMART
ZnF_C2H2	208	231	1.6e-3	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	1.7e-5	SMART
ZnF_C2H2	388	410	3.5e-5	SMART
ZnF_C2H2	421	444	1.1e-3	SMART
ZnF_C2H2	462	484	7.2e-7	SMART
ZnF_C2H2	490	513	5.9e-3	SMART
ZnF_C2H2	517	540	4.7e-6	SMART
ZnF_C2H2	546	568	5.7e-5	SMART
ZnF_C2H2	574	596	1.3e-4	SMART
ZnF_C2H2	602	624	3e-6	SMART
ZnF_C2H2	630	653	1.5e-5	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Zbtb41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Zbtb41	APN	1	139430324	missense	probably benign	0.01
IGL01796:Zbtb41	APN	1	139442883	missense	probably damaging	0.99
IGL01844:Zbtb41	APN	1	139447327	missense	probably benign	0.01
IGL02150:Zbtb41	APN	1	139440448	missense	possibly damaging	0.73
IGL02346:Zbtb41	APN	1	139447100	missense	probably damaging	1.00
IGL03139:Zbtb41	APN	1	139423838	missense	probably benign	0.00
IGL03215:Zbtb41	APN	1	139446950	missense	probably damaging	1.00
IGL03309:Zbtb41	APN	1	139432078	critical splice donor site	probably null
memorialized	UTSW	1	139440394	missense	probably benign	0.00
Noted	UTSW	1	139439031	missense	probably damaging	0.99
R7584_zbtb41_939	UTSW	1	139424057	missense	probably benign	0.14
unforgotten	UTSW	1	139432078	critical splice donor site	probably null
R0004:Zbtb41	UTSW	1	139442888	missense	possibly damaging	0.90
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0048:Zbtb41	UTSW	1	139441834	missense	probably damaging	1.00
R0230:Zbtb41	UTSW	1	139446935	missense	probably damaging	1.00
R0309:Zbtb41	UTSW	1	139438984	missense	probably damaging	0.99
R0458:Zbtb41	UTSW	1	139423476	missense	probably damaging	1.00
R0606:Zbtb41	UTSW	1	139423610	missense	probably benign	0.28
R0964:Zbtb41	UTSW	1	139439031	missense	probably damaging	0.99
R1531:Zbtb41	UTSW	1	139423193	missense	probably benign	0.00
R1723:Zbtb41	UTSW	1	139423563	missense	probably benign	0.39
R1765:Zbtb41	UTSW	1	139440394	missense	probably benign	0.00
R1829:Zbtb41	UTSW	1	139446922	nonsense	probably null
R2077:Zbtb41	UTSW	1	139424093	missense	probably damaging	1.00
R2292:Zbtb41	UTSW	1	139440359	missense	probably damaging	0.99
R2380:Zbtb41	UTSW	1	139423814	missense	probably damaging	0.99
R2402:Zbtb41	UTSW	1	139423185	missense	probably benign	0.10
R2402:Zbtb41	UTSW	1	139423187	nonsense	probably null
R3848:Zbtb41	UTSW	1	139423996	missense	probably benign
R3849:Zbtb41	UTSW	1	139423996	missense	probably benign
R4077:Zbtb41	UTSW	1	139429326	missense	probably benign	0.11
R4641:Zbtb41	UTSW	1	139442819	missense	probably damaging	0.98
R4772:Zbtb41	UTSW	1	139447414	missense	probably damaging	1.00
R5646:Zbtb41	UTSW	1	139423763	missense	probably benign	0.05
R5754:Zbtb41	UTSW	1	139432078	critical splice donor site	probably null
R6002:Zbtb41	UTSW	1	139423659	missense	probably damaging	1.00
R6045:Zbtb41	UTSW	1	139424032	missense	probably benign	0.34
R6302:Zbtb41	UTSW	1	139429289	missense	possibly damaging	0.67
R6318:Zbtb41	UTSW	1	139430306	missense	possibly damaging	0.91
R6430:Zbtb41	UTSW	1	139447207	missense	probably benign	0.02
R6906:Zbtb41	UTSW	1	139423390	missense	possibly damaging	0.59
R7584:Zbtb41	UTSW	1	139424057	missense	probably benign	0.14
R7753:Zbtb41	UTSW	1	139447157	missense	probably benign
R8132:Zbtb41	UTSW	1	139423217	missense	probably benign	0.00
R8138:Zbtb41	UTSW	1	139441807	missense	probably damaging	1.00
R8205:Zbtb41	UTSW	1	139429181	missense	possibly damaging	0.96
R8823:Zbtb41	UTSW	1	139423154	missense	probably damaging	1.00
R8967:Zbtb41	UTSW	1	139442849	missense	probably benign
R9431:Zbtb41	UTSW	1	139423043	start gained	probably benign
R9500:Zbtb41	UTSW	1	139432068	missense	probably damaging	1.00
R9559:Zbtb41	UTSW	1	139430315	missense	probably benign	0.14
R9603:Zbtb41	UTSW	1	139447517	missense	probably damaging	1.00
R9789:Zbtb41	UTSW	1	139440346	missense	probably damaging	1.00
Z1177:Zbtb41	UTSW	1	139423416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATTTAGCCAAAACTCACAGGTC -3'
(R):5'- TCACATTTGGGACACTGCAG -3'

Sequencing Primer
(F):5'- ACAGGTCTCTGCTCCTTGGG -3'
(R):5'- GAGCTAACCCTTCATGGATGC -3'

Posted On

2015-04-06