Incidental Mutation 'R3847:Zbtb41'
ID277403
Institutional Source Beutler Lab
Gene Symbol Zbtb41
Ensembl Gene ENSMUSG00000033964
Gene Namezinc finger and BTB domain containing 41
Synonyms9830132G07Rik, 8430415N23Rik
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139422288-139453005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139423996 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 282 (H282Q)
Ref Sequence ENSEMBL: ENSMUSP00000142797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]
Predicted Effect probably benign
Transcript: ENSMUST00000039867
AA Change: H282Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: H282Q

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 7.06e-16 SMART
ZnF_C2H2 208 231 3.78e-1 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 4.17e-3 SMART
ZnF_C2H2 388 410 8.34e-3 SMART
ZnF_C2H2 421 444 2.67e-1 SMART
ZnF_C2H2 462 484 1.72e-4 SMART
ZnF_C2H2 490 513 1.41e0 SMART
ZnF_C2H2 517 540 1.12e-3 SMART
ZnF_C2H2 546 568 1.36e-2 SMART
ZnF_C2H2 574 596 2.91e-2 SMART
ZnF_C2H2 602 624 7.37e-4 SMART
ZnF_C2H2 630 653 3.39e-3 SMART
ZnF_C2H2 667 689 2.75e-3 SMART
ZnF_C2H2 695 717 3.16e-3 SMART
ZnF_C2H2 723 746 3.34e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000199011
AA Change: H114Q
Predicted Effect probably benign
Transcript: ENSMUST00000200243
AA Change: H282Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: H282Q

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 4.7e-18 SMART
ZnF_C2H2 208 231 1.6e-3 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 1.7e-5 SMART
ZnF_C2H2 388 410 3.5e-5 SMART
ZnF_C2H2 421 444 1.1e-3 SMART
ZnF_C2H2 462 484 7.2e-7 SMART
ZnF_C2H2 490 513 5.9e-3 SMART
ZnF_C2H2 517 540 4.7e-6 SMART
ZnF_C2H2 546 568 5.7e-5 SMART
ZnF_C2H2 574 596 1.3e-4 SMART
ZnF_C2H2 602 624 3e-6 SMART
ZnF_C2H2 630 653 1.5e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Zbtb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Zbtb41 APN 1 139430324 missense probably benign 0.01
IGL01796:Zbtb41 APN 1 139442883 missense probably damaging 0.99
IGL01844:Zbtb41 APN 1 139447327 missense probably benign 0.01
IGL02150:Zbtb41 APN 1 139440448 missense possibly damaging 0.73
IGL02346:Zbtb41 APN 1 139447100 missense probably damaging 1.00
IGL03139:Zbtb41 APN 1 139423838 missense probably benign 0.00
IGL03215:Zbtb41 APN 1 139446950 missense probably damaging 1.00
IGL03309:Zbtb41 APN 1 139432078 critical splice donor site probably null
memorialized UTSW 1 139440394 missense probably benign 0.00
Noted UTSW 1 139439031 missense probably damaging 0.99
R7584_zbtb41_939 UTSW 1 139424057 missense probably benign 0.14
unforgotten UTSW 1 139432078 critical splice donor site probably null
R0004:Zbtb41 UTSW 1 139442888 missense possibly damaging 0.90
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0048:Zbtb41 UTSW 1 139441834 missense probably damaging 1.00
R0230:Zbtb41 UTSW 1 139446935 missense probably damaging 1.00
R0309:Zbtb41 UTSW 1 139438984 missense probably damaging 0.99
R0458:Zbtb41 UTSW 1 139423476 missense probably damaging 1.00
R0606:Zbtb41 UTSW 1 139423610 missense probably benign 0.28
R0964:Zbtb41 UTSW 1 139439031 missense probably damaging 0.99
R1531:Zbtb41 UTSW 1 139423193 missense probably benign 0.00
R1723:Zbtb41 UTSW 1 139423563 missense probably benign 0.39
R1765:Zbtb41 UTSW 1 139440394 missense probably benign 0.00
R1829:Zbtb41 UTSW 1 139446922 nonsense probably null
R2077:Zbtb41 UTSW 1 139424093 missense probably damaging 1.00
R2292:Zbtb41 UTSW 1 139440359 missense probably damaging 0.99
R2380:Zbtb41 UTSW 1 139423814 missense probably damaging 0.99
R2402:Zbtb41 UTSW 1 139423185 missense probably benign 0.10
R2402:Zbtb41 UTSW 1 139423187 nonsense probably null
R3848:Zbtb41 UTSW 1 139423996 missense probably benign
R3849:Zbtb41 UTSW 1 139423996 missense probably benign
R4077:Zbtb41 UTSW 1 139429326 missense probably benign 0.11
R4641:Zbtb41 UTSW 1 139442819 missense probably damaging 0.98
R4772:Zbtb41 UTSW 1 139447414 missense probably damaging 1.00
R5646:Zbtb41 UTSW 1 139423763 missense probably benign 0.05
R5754:Zbtb41 UTSW 1 139432078 critical splice donor site probably null
R6002:Zbtb41 UTSW 1 139423659 missense probably damaging 1.00
R6045:Zbtb41 UTSW 1 139424032 missense probably benign 0.34
R6302:Zbtb41 UTSW 1 139429289 missense possibly damaging 0.67
R6318:Zbtb41 UTSW 1 139430306 missense possibly damaging 0.91
R6430:Zbtb41 UTSW 1 139447207 missense probably benign 0.02
R6906:Zbtb41 UTSW 1 139423390 missense possibly damaging 0.59
R7584:Zbtb41 UTSW 1 139424057 missense probably benign 0.14
R7753:Zbtb41 UTSW 1 139447157 missense probably benign
R8132:Zbtb41 UTSW 1 139423217 missense probably benign 0.00
R8138:Zbtb41 UTSW 1 139441807 missense probably damaging 1.00
R8205:Zbtb41 UTSW 1 139429181 missense possibly damaging 0.96
R8823:Zbtb41 UTSW 1 139423154 missense probably damaging 1.00
Z1177:Zbtb41 UTSW 1 139423416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTAGCCAAAACTCACAGGTC -3'
(R):5'- TCACATTTGGGACACTGCAG -3'

Sequencing Primer
(F):5'- ACAGGTCTCTGCTCCTTGGG -3'
(R):5'- GAGCTAACCCTTCATGGATGC -3'
Posted On2015-04-06