Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Gad2'

277406

Institutional Source

Beutler Lab

Gene Symbol

Gad2

Ensembl Gene

ENSMUSG00000026787

Gene Name

glutamic acid decarboxylase 2

Synonyms

Gad-2, 6330404F12Rik, GAD(65), GAD65

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22622205-22693874 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 22684988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 472 (D472E)

Ref Sequence

ENSEMBL: ENSMUSP00000028123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028123]

AlphaFold

P48320

Predicted Effect

probably benign
Transcript: ENSMUST00000028123
AA Change: D472E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787
AA Change: D472E

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	138	509	7.8e-138	PFAM

Meta Mutation Damage Score

0.0824

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Gad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Gad2	APN	2	22685386	missense	probably benign	0.07
IGL00870:Gad2	APN	2	22629971	missense	probably benign	0.42
IGL01142:Gad2	APN	2	22681285	splice site	probably benign
IGL01577:Gad2	APN	2	22681280	splice site	probably benign
IGL01671:Gad2	APN	2	22623699	nonsense	probably null
IGL02346:Gad2	APN	2	22629939	splice site	probably benign
IGL02348:Gad2	APN	2	22629393	missense	probably damaging	1.00
IGL03113:Gad2	APN	2	22681355	missense	probably benign	0.09
gruene	UTSW	2	22685067	critical splice donor site	probably null
Mosey	UTSW	2	22668257	missense	probably damaging	1.00
R0630:Gad2	UTSW	2	22690336	missense	probably benign	0.14
R1109:Gad2	UTSW	2	22681394	missense	probably damaging	1.00
R1109:Gad2	UTSW	2	22690159	splice site	probably benign
R1122:Gad2	UTSW	2	22623451	missense	possibly damaging	0.68
R1604:Gad2	UTSW	2	22623840	critical splice donor site	probably null
R1773:Gad2	UTSW	2	22690207	missense	probably benign
R1895:Gad2	UTSW	2	22685428	missense	probably benign
R1946:Gad2	UTSW	2	22685428	missense	probably benign
R2329:Gad2	UTSW	2	22668289	missense	probably damaging	1.00
R2857:Gad2	UTSW	2	22673975	missense	probably benign	0.02
R3754:Gad2	UTSW	2	22681340	missense	possibly damaging	0.91
R4382:Gad2	UTSW	2	22685410	missense	probably benign
R4383:Gad2	UTSW	2	22685410	missense	probably benign
R4384:Gad2	UTSW	2	22685410	missense	probably benign
R4651:Gad2	UTSW	2	22668362	missense	probably damaging	1.00
R4700:Gad2	UTSW	2	22673970	missense	probably damaging	1.00
R4766:Gad2	UTSW	2	22622667	missense	probably damaging	0.99
R5279:Gad2	UTSW	2	22673957	missense	probably benign	0.38
R5372:Gad2	UTSW	2	22690243	missense	possibly damaging	0.84
R5505:Gad2	UTSW	2	22624833	missense	probably benign
R5820:Gad2	UTSW	2	22690249	missense	probably benign	0.00
R5868:Gad2	UTSW	2	22685067	critical splice donor site	probably null
R6026:Gad2	UTSW	2	22623736	missense	probably benign	0.00
R6497:Gad2	UTSW	2	22668257	missense	probably damaging	1.00
R6675:Gad2	UTSW	2	22673985	missense	possibly damaging	0.67
R7157:Gad2	UTSW	2	22635023	missense	probably damaging	0.98
R7352:Gad2	UTSW	2	22623823	missense	probably benign	0.00
R7951:Gad2	UTSW	2	22623487	missense	probably damaging	0.96
R8285:Gad2	UTSW	2	22624928	missense	probably benign	0.45
R8549:Gad2	UTSW	2	22635047	critical splice donor site	probably null
R8737:Gad2	UTSW	2	22634973	nonsense	probably null
R9012:Gad2	UTSW	2	22690251	missense	possibly damaging	0.56
R9184:Gad2	UTSW	2	22668319	missense	probably benign
R9212:Gad2	UTSW	2	22681387	missense	probably damaging	1.00
R9243:Gad2	UTSW	2	22635041	missense	possibly damaging	0.79
R9395:Gad2	UTSW	2	22624867	missense	probably damaging	0.96
X0019:Gad2	UTSW	2	22690172	critical splice acceptor site	probably null
Z1177:Gad2	UTSW	2	22635014	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGTGTCAAAGTGGCAGGGC -3'
(R):5'- TCTTTATCCCAGCTCAAAGGAACC -3'

Sequencing Primer
(F):5'- GGCAGGGCCGGAAATGG -3'
(R):5'- GTAATGGTCCCACTTAGCCAG -3'

Posted On

2015-04-06