Incidental Mutation 'R3847:Ttc21b'
ID277409
Institutional Source Beutler Lab
Gene Symbol Ttc21b
Ensembl Gene ENSMUSG00000034848
Gene Nametetratricopeptide repeat domain 21B
Synonymsline 158, Thm1, aln, 2410066K11Rik
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66184327-66256617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66242679 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 221 (L221S)
Ref Sequence ENSEMBL: ENSMUSP00000131758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]
Predicted Effect probably damaging
Transcript: ENSMUST00000102718
AA Change: L221S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: L221S

DomainStartEndE-ValueType
Blast:TPR 109 141 5e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 5e-13 BLAST
Blast:TPR 1156 1189 1e-12 BLAST
TPR 1196 1229 9.7e0 SMART
TPR 1265 1298 1.02e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125446
AA Change: L221S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848
AA Change: L221S

DomainStartEndE-ValueType
Blast:TPR 108 141 3e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 4e-13 BLAST
Blast:TPR 1156 1189 9e-13 BLAST
TPR 1196 1229 9.7e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131503
Meta Mutation Damage Score 0.8328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Ttc21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Ttc21b APN 2 66242775 missense probably benign 0.00
IGL00467:Ttc21b APN 2 66188364 missense probably damaging 1.00
IGL00721:Ttc21b APN 2 66226778 missense probably benign 0.06
IGL00837:Ttc21b APN 2 66235571 critical splice donor site probably null
IGL01317:Ttc21b APN 2 66188356 missense probably benign 0.00
IGL01485:Ttc21b APN 2 66251890 splice site probably benign
IGL01739:Ttc21b APN 2 66237856 missense probably benign
IGL02282:Ttc21b APN 2 66191737 missense probably damaging 0.96
IGL02431:Ttc21b APN 2 66251885 splice site probably benign
IGL02478:Ttc21b APN 2 66188280 missense probably benign 0.05
IGL02487:Ttc21b APN 2 66235156 missense probably benign 0.02
IGL03327:Ttc21b APN 2 66237848 missense possibly damaging 0.92
IGL03346:Ttc21b APN 2 66237848 missense possibly damaging 0.92
plus-sized UTSW 2 66242679 missense probably damaging 1.00
R6482_Ttc21b_149 UTSW 2 66226900 missense probably benign 0.12
PIT4696001:Ttc21b UTSW 2 66231219 splice site probably null
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0373:Ttc21b UTSW 2 66188326 missense probably damaging 0.99
R0440:Ttc21b UTSW 2 66236382 missense probably benign 0.03
R0504:Ttc21b UTSW 2 66222798 splice site probably benign
R0600:Ttc21b UTSW 2 66239570 missense probably damaging 0.99
R0621:Ttc21b UTSW 2 66226011 missense probably benign 0.07
R0633:Ttc21b UTSW 2 66236233 missense probably benign
R0863:Ttc21b UTSW 2 66242773 missense probably benign
R1617:Ttc21b UTSW 2 66226035 missense probably benign 0.22
R1837:Ttc21b UTSW 2 66197762 missense probably benign 0.01
R1844:Ttc21b UTSW 2 66223577 nonsense probably null
R2120:Ttc21b UTSW 2 66226754 missense probably benign 0.12
R2205:Ttc21b UTSW 2 66235123 missense possibly damaging 0.51
R2392:Ttc21b UTSW 2 66207450 critical splice donor site probably null
R3689:Ttc21b UTSW 2 66224144 missense probably benign 0.22
R3810:Ttc21b UTSW 2 66252233 critical splice acceptor site probably null
R3897:Ttc21b UTSW 2 66235069 missense probably benign 0.01
R4561:Ttc21b UTSW 2 66186218 missense probably damaging 1.00
R4671:Ttc21b UTSW 2 66226913 missense possibly damaging 0.66
R5161:Ttc21b UTSW 2 66229023 missense probably damaging 0.98
R5274:Ttc21b UTSW 2 66236283 missense possibly damaging 0.89
R5594:Ttc21b UTSW 2 66236235 missense probably benign 0.39
R6210:Ttc21b UTSW 2 66236354 missense probably benign 0.00
R6305:Ttc21b UTSW 2 66188270 missense probably damaging 0.99
R6456:Ttc21b UTSW 2 66188331 missense probably damaging 0.97
R6482:Ttc21b UTSW 2 66226900 missense probably benign 0.12
R6645:Ttc21b UTSW 2 66236377 missense probably benign 0.01
R6800:Ttc21b UTSW 2 66208650 splice site probably null
R6815:Ttc21b UTSW 2 66226790 missense probably benign 0.00
R6959:Ttc21b UTSW 2 66231312 missense probably benign 0.05
R7125:Ttc21b UTSW 2 66236326 missense probably benign 0.00
R7265:Ttc21b UTSW 2 66210173 missense possibly damaging 0.89
R7283:Ttc21b UTSW 2 66208718 missense probably damaging 0.96
R7560:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7561:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7816:Ttc21b UTSW 2 66247361 missense possibly damaging 0.82
R8172:Ttc21b UTSW 2 66252156 missense probably benign 0.01
R8179:Ttc21b UTSW 2 66201480 missense probably benign
X0013:Ttc21b UTSW 2 66225950 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCACACTGAGGCAGTATGGTTTC -3'
(R):5'- AGAATGATGTGCAACCTTGTTG -3'

Sequencing Primer
(F):5'- CTGTCTATGTTCCCACAAATGAGGG -3'
(R):5'- TATTCTGAAATAGCCCGGGC -3'
Posted On2015-04-06