Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Blvra'

277413

Institutional Source

Beutler Lab

Gene Symbol

Blvra

Ensembl Gene

ENSMUSG00000001999

Gene Name

biliverdin reductase A

Synonyms

0610006A11Rik, Blvr, 2500001N03Rik

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127070665-127097084 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127095191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 188 (T188I)

Ref Sequence

ENSEMBL: ENSMUSP00000002064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002064] [ENSMUST00000135529] [ENSMUST00000142737]

AlphaFold

Q9CY64

Predicted Effect

probably damaging
Transcript: ENSMUST00000002064
AA Change: T188I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999
AA Change: T188I

Domain	Start	End	E-Value	Type
Pfam:GFO_IDH_MocA	9	124	2.1e-22	PFAM
Pfam:Biliv-reduc_cat	132	244	2.6e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135529

SMART Domains

Protein: ENSMUSP00000118278
Gene: ENSMUSG00000001999

Domain	Start	End	E-Value	Type
Pfam:GFO_IDH_MocA	9	123	1e-22	PFAM
transmembrane domain	125	147	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142737

SMART Domains

Protein: ENSMUSP00000116825
Gene: ENSMUSG00000001999

Domain	Start	End	E-Value	Type
Pfam:GFO_IDH_MocA	9	124	4.7e-24	PFAM
Pfam:NAD_binding_3	15	122	1.8e-8	PFAM

Meta Mutation Damage Score

0.2602

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: This locus controls electrophoretic mobility of biliverdin reductase. The a allele determines a slowly migrating band in C3H/He, C57BL/H and 101/H; the b allele determines a fast band in BALB/c, CBA/Ca, TFH/H and SM/J. Heterozygotes have both parental bands. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Blvra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03149:Blvra	APN	2	127082951	missense	probably damaging	1.00
R1084:Blvra	UTSW	2	127080653	missense	probably benign	0.00
R1932:Blvra	UTSW	2	127095148	missense	probably damaging	1.00
R2114:Blvra	UTSW	2	127086069	nonsense	probably null
R2115:Blvra	UTSW	2	127086069	nonsense	probably null
R2117:Blvra	UTSW	2	127086069	nonsense	probably null
R2122:Blvra	UTSW	2	127086897	missense	probably damaging	0.96
R3734:Blvra	UTSW	2	127090255	intron	probably benign
R4110:Blvra	UTSW	2	127095155	missense	probably damaging	1.00
R4533:Blvra	UTSW	2	127090384	splice site	probably null
R4620:Blvra	UTSW	2	127096965	missense	probably damaging	1.00
R4702:Blvra	UTSW	2	127092062	missense	probably benign	0.01
R5921:Blvra	UTSW	2	127087363	intron	probably benign
R6322:Blvra	UTSW	2	127080539	start gained	probably benign
R7474:Blvra	UTSW	2	127086849	missense	probably damaging	1.00
R7486:Blvra	UTSW	2	127087323	missense	unknown
R8188:Blvra	UTSW	2	127095127	missense	probably damaging	1.00
R9101:Blvra	UTSW	2	127085970	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGCGAGATGTCCTTTTCTC -3'
(R):5'- GCAGTAGTTCTCCTGACAGG -3'

Sequencing Primer
(F):5'- AGGCGAGATGTCCTTTTCTCAGATC -3'
(R):5'- TCCTGACAGGAGCAGGCAC -3'

Posted On

2015-04-06