Incidental Mutation 'R3847:Bmp8b'
ID277418
Institutional Source Beutler Lab
Gene Symbol Bmp8b
Ensembl Gene ENSMUSG00000002384
Gene Namebone morphogenetic protein 8b
SynonymsOp3
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123105165-123132099 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 123116168 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
Predicted Effect probably benign
Transcript: ENSMUST00000002457
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102648
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Predicted Effect unknown
Transcript: ENSMUST00000166337
AA Change: V82L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194481
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The encoded protein may play a role in the generation of primordial germ cells, and has been shown to stimulate thermogenesis in brown adipose tissue. Male mice lacking a functional copy of this gene exhibit variable degrees of germ-cell deficiency. Homozygous knockout mice of both sexes exhibit impaired thermogenesis and reduced metabolic rate, resulting in weight gain. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: Incidence of lethality among homozygous null mutants is variable depending on genetic background and due to allantoic and embryonic abnormalities. Heterozygous and surviving homozygous males exhibit varying degrees of germ cell deficiency and infertility, also background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Bmp8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Bmp8b APN 4 123124409 missense probably benign 0.19
R0334:Bmp8b UTSW 4 123114760 splice site probably null
R0441:Bmp8b UTSW 4 123124515 missense probably damaging 1.00
R0472:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0609:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0732:Bmp8b UTSW 4 123105406 missense unknown
R1221:Bmp8b UTSW 4 123114711 missense probably damaging 1.00
R2200:Bmp8b UTSW 4 123123022 missense possibly damaging 0.81
R4003:Bmp8b UTSW 4 123121878 unclassified probably benign
R4777:Bmp8b UTSW 4 123122000 missense possibly damaging 0.61
R4834:Bmp8b UTSW 4 123123050 missense probably damaging 1.00
R4911:Bmp8b UTSW 4 123115237 missense probably damaging 1.00
R5207:Bmp8b UTSW 4 123115921 unclassified probably benign
R5509:Bmp8b UTSW 4 123114576 missense possibly damaging 0.78
R5549:Bmp8b UTSW 4 123124485 missense probably damaging 1.00
R5795:Bmp8b UTSW 4 123121968 missense possibly damaging 0.59
R6142:Bmp8b UTSW 4 123115250 missense probably benign
R7549:Bmp8b UTSW 4 123105655 missense possibly damaging 0.61
R7712:Bmp8b UTSW 4 123124464 missense possibly damaging 0.90
R8245:Bmp8b UTSW 4 123114739 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAACCTGGAACTGCCCCATC -3'
(R):5'- CGTGTAGAAATGGACACTCCCG -3'

Sequencing Primer
(F):5'- GGAACTGCCCCATCCCCAC -3'
(R):5'- TGCGGTCCGAAACATAGC -3'
Posted On2015-04-06