Incidental Mutation 'R3847:Bmp8b'
ID 277418
Institutional Source Beutler Lab
Gene Symbol Bmp8b
Ensembl Gene ENSMUSG00000002384
Gene Name bone morphogenetic protein 8b
Synonyms Op3
MMRRC Submission 040895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R3847 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 122998101-123019887 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 123009961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
AlphaFold P55105
Predicted Effect probably benign
Transcript: ENSMUST00000002457
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102648
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Predicted Effect unknown
Transcript: ENSMUST00000166337
AA Change: V82L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194481
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The encoded protein may play a role in the generation of primordial germ cells, and has been shown to stimulate thermogenesis in brown adipose tissue. Male mice lacking a functional copy of this gene exhibit variable degrees of germ-cell deficiency. Homozygous knockout mice of both sexes exhibit impaired thermogenesis and reduced metabolic rate, resulting in weight gain. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: Incidence of lethality among homozygous null mutants is variable depending on genetic background and due to allantoic and embryonic abnormalities. Heterozygous and surviving homozygous males exhibit varying degrees of germ cell deficiency and infertility, also background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,884,190 (GRCm39) probably null Het
Abcc12 C T 8: 87,280,020 (GRCm39) E338K probably benign Het
Abcc5 A T 16: 20,190,906 (GRCm39) S815T probably benign Het
Ankrd16 G A 2: 11,794,619 (GRCm39) E335K probably benign Het
Atm A G 9: 53,414,375 (GRCm39) F905S possibly damaging Het
Bckdha C T 7: 25,331,077 (GRCm39) R281H probably damaging Het
Blvra C T 2: 126,937,111 (GRCm39) T188I probably damaging Het
Cacna2d3 A G 14: 29,069,077 (GRCm39) probably null Het
Cacng8 T C 7: 3,442,990 (GRCm39) S84P probably damaging Het
Cad T A 5: 31,218,994 (GRCm39) V605E probably damaging Het
Ccny A G 18: 9,449,641 (GRCm39) S11P probably benign Het
Col3a1 C A 1: 45,361,150 (GRCm39) P112T unknown Het
Corin T C 5: 72,579,508 (GRCm39) E155G probably benign Het
Cul9 T C 17: 46,836,061 (GRCm39) Y1195C probably damaging Het
Cyp27a1 A G 1: 74,776,718 (GRCm39) E501G probably damaging Het
Dennd3 T A 15: 73,414,581 (GRCm39) N457K possibly damaging Het
Dnah7a T G 1: 53,540,815 (GRCm39) I2520L probably benign Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Fgf14 A C 14: 124,217,801 (GRCm39) I234R probably benign Het
Foxp4 A G 17: 48,186,453 (GRCm39) I442T unknown Het
Gad2 T G 2: 22,575,000 (GRCm39) D472E probably benign Het
Garnl3 G T 2: 32,882,240 (GRCm39) H832N probably benign Het
Gm13941 T C 2: 110,935,198 (GRCm39) M11V unknown Het
Gnptab T A 10: 88,269,439 (GRCm39) L714* probably null Het
Golgb1 C A 16: 36,719,095 (GRCm39) Q334K probably benign Het
Gp9 A G 6: 87,756,133 (GRCm39) I49M probably benign Het
Guf1 A G 5: 69,718,500 (GRCm39) N213S probably damaging Het
H2-K2 T G 17: 34,216,303 (GRCm39) H281P probably damaging Het
Hhip T A 8: 80,724,124 (GRCm39) M373L probably benign Het
Ifi203 C T 1: 173,761,362 (GRCm39) C229Y possibly damaging Het
Ighv13-2 A G 12: 114,321,418 (GRCm39) L88S probably damaging Het
Kcna3 T C 3: 106,944,012 (GRCm39) Y92H possibly damaging Het
Lmo7 A G 14: 102,159,531 (GRCm39) probably null Het
Lrguk A G 6: 34,050,703 (GRCm39) D387G probably damaging Het
Mki67 A C 7: 135,297,859 (GRCm39) S2392A probably benign Het
Mknk2 C T 10: 80,503,809 (GRCm39) W367* probably null Het
Mocos A G 18: 24,809,719 (GRCm39) K441E probably damaging Het
Mpnd T C 17: 56,318,692 (GRCm39) S150P probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Neurod4 C T 10: 130,106,351 (GRCm39) V308I probably benign Het
Nxf3 C T X: 134,974,732 (GRCm39) V474I probably benign Het
Or10d5j A T 9: 39,867,877 (GRCm39) M118K probably damaging Het
Or8u10 A T 2: 85,915,751 (GRCm39) Y123* probably null Het
Pam T A 1: 97,782,481 (GRCm39) probably benign Het
Pde5a T C 3: 122,596,809 (GRCm39) Y467H probably damaging Het
Pibf1 T A 14: 99,374,557 (GRCm39) V332E possibly damaging Het
Plxna1 C A 6: 89,333,501 (GRCm39) R376L probably damaging Het
Proz A G 8: 13,123,533 (GRCm39) E268G probably benign Het
Rimbp3 A T 16: 17,028,163 (GRCm39) H529L probably benign Het
Rnf103 C G 6: 71,485,859 (GRCm39) C163W probably damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Septin11 G T 5: 93,310,026 (GRCm39) M276I probably damaging Het
Slc30a4 A G 2: 122,544,192 (GRCm39) V50A probably damaging Het
Sorbs1 A G 19: 40,302,887 (GRCm39) V570A probably damaging Het
Spout1 T C 2: 30,067,419 (GRCm39) probably null Het
Syne2 T C 12: 76,095,396 (GRCm39) L5241P probably damaging Het
Tas2r110 T A 6: 132,845,638 (GRCm39) I223N probably damaging Het
Tead2 T A 7: 44,881,752 (GRCm39) probably null Het
Thsd1 A G 8: 22,749,427 (GRCm39) H713R probably damaging Het
Ttc21b A G 2: 66,073,023 (GRCm39) L221S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r105 A G 17: 20,428,952 (GRCm39) I708T possibly damaging Het
Vmn2r117 G T 17: 23,679,389 (GRCm39) H612N probably damaging Het
Wnk1 C T 6: 119,946,315 (GRCm39) G613S possibly damaging Het
Zbtb41 T A 1: 139,351,734 (GRCm39) H282Q probably benign Het
Zfp335 C A 2: 164,742,026 (GRCm39) probably null Het
Zmym2 T A 14: 57,158,956 (GRCm39) probably benign Het
Other mutations in Bmp8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Bmp8b APN 4 123,018,202 (GRCm39) missense probably benign 0.19
R0334:Bmp8b UTSW 4 123,008,553 (GRCm39) splice site probably null
R0441:Bmp8b UTSW 4 123,018,308 (GRCm39) missense probably damaging 1.00
R0472:Bmp8b UTSW 4 123,015,692 (GRCm39) missense probably benign 0.06
R0609:Bmp8b UTSW 4 123,015,692 (GRCm39) missense probably benign 0.06
R0732:Bmp8b UTSW 4 122,999,199 (GRCm39) missense unknown
R1221:Bmp8b UTSW 4 123,008,504 (GRCm39) missense probably damaging 1.00
R2200:Bmp8b UTSW 4 123,016,815 (GRCm39) missense possibly damaging 0.81
R4003:Bmp8b UTSW 4 123,015,671 (GRCm39) unclassified probably benign
R4777:Bmp8b UTSW 4 123,015,793 (GRCm39) missense possibly damaging 0.61
R4834:Bmp8b UTSW 4 123,016,843 (GRCm39) missense probably damaging 1.00
R4911:Bmp8b UTSW 4 123,009,030 (GRCm39) missense probably damaging 1.00
R5207:Bmp8b UTSW 4 123,009,714 (GRCm39) unclassified probably benign
R5509:Bmp8b UTSW 4 123,008,369 (GRCm39) missense possibly damaging 0.78
R5549:Bmp8b UTSW 4 123,018,278 (GRCm39) missense probably damaging 1.00
R5795:Bmp8b UTSW 4 123,015,761 (GRCm39) missense possibly damaging 0.59
R6142:Bmp8b UTSW 4 123,009,043 (GRCm39) missense probably benign
R7549:Bmp8b UTSW 4 122,999,448 (GRCm39) missense possibly damaging 0.61
R7712:Bmp8b UTSW 4 123,018,257 (GRCm39) missense possibly damaging 0.90
R8245:Bmp8b UTSW 4 123,008,532 (GRCm39) missense probably benign 0.01
R9788:Bmp8b UTSW 4 122,999,369 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCTGGAACTGCCCCATC -3'
(R):5'- CGTGTAGAAATGGACACTCCCG -3'

Sequencing Primer
(F):5'- GGAACTGCCCCATCCCCAC -3'
(R):5'- TGCGGTCCGAAACATAGC -3'
Posted On 2015-04-06