Incidental Mutation 'R3847:Bckdha'
ID277431
Institutional Source Beutler Lab
Gene Symbol Bckdha
Ensembl Gene ENSMUSG00000060376
Gene Namebranched chain ketoacid dehydrogenase E1, alpha polypeptide
SynonymsBCKAD E1[a]
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25629946-25658981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25631652 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 281 (R281H)
Ref Sequence ENSEMBL: ENSMUSP00000071292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071329] [ENSMUST00000076034] [ENSMUST00000205281] [ENSMUST00000205808] [ENSMUST00000206940]
Predicted Effect probably damaging
Transcript: ENSMUST00000071329
AA Change: R281H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071292
Gene: ENSMUSG00000060376
AA Change: R281H

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Pfam:E1_dh 107 407 2.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076034
SMART Domains Protein: ENSMUSP00000092277
Gene: ENSMUSG00000059479

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:Galactosyl_T 154 344 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205281
Predicted Effect probably benign
Transcript: ENSMUST00000205808
AA Change: R31H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206824
Predicted Effect probably benign
Transcript: ENSMUST00000206940
Meta Mutation Damage Score 0.3063 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Bckdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Bckdha APN 7 25633342 missense probably benign 0.00
IGL01322:Bckdha APN 7 25658707 missense possibly damaging 0.75
IGL02279:Bckdha APN 7 25631109 missense probably damaging 1.00
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0194:Bckdha UTSW 7 25631450 missense probably damaging 1.00
R0615:Bckdha UTSW 7 25641785 missense probably benign 0.00
R1806:Bckdha UTSW 7 25631420 missense probably damaging 1.00
R2520:Bckdha UTSW 7 25641699 missense probably benign 0.18
R3975:Bckdha UTSW 7 25631433 missense probably damaging 1.00
R4630:Bckdha UTSW 7 25631459 missense probably damaging 1.00
R5655:Bckdha UTSW 7 25630364 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
Z1176:Bckdha UTSW 7 25631143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTGACATGATGCCGTACCC -3'
(R):5'- TCATCTGTGTCCCTGTGCAG -3'

Sequencing Primer
(F):5'- GTACCCAGGGCCCCGAG -3'
(R):5'- TGTCCCTGTGCAGCGGTAG -3'
Posted On2015-04-06