Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Mki67'

277433

Institutional Source

Beutler Lab

Gene Symbol

Mki67

Ensembl Gene

ENSMUSG00000031004

Gene Name

antigen identified by monoclonal antibody Ki 67

Synonyms

D630048A14Rik, Ki-67, Ki67

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.831) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135689784-135716361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 135696130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 2392 (S2392A)

Ref Sequence

ENSEMBL: ENSMUSP00000033310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033310]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033310
AA Change: S2392A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: S2392A

Domain	Start	End	E-Value	Type
FHA	26	76	1.03e-11	SMART
Pfam:PP1_bind	462	519	2.8e-20	PFAM
low complexity region	535	545	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
Pfam:K167R	889	982	1.5e-9	PFAM
K167R	993	1102	2.01e-39	SMART
K167R	1107	1217	1.87e-57	SMART
K167R	1228	1337	1.33e-53	SMART
K167R	1348	1451	6.57e-44	SMART
K167R	1462	1570	9.09e-38	SMART
K167R	1580	1686	5.02e-40	SMART
K167R	1697	1807	9.6e-37	SMART
K167R	1818	1926	5.94e-51	SMART
K167R	1937	2047	1.6e-56	SMART
K167R	2058	2164	4.04e-53	SMART
K167R	2175	2285	1.52e-57	SMART
K167R	2296	2407	1.78e-40	SMART
K167R	2418	2527	1.71e-42	SMART
K167R	2538	2640	7.41e-20	SMART
K167R	2642	2750	1.06e-38	SMART
K167R	2761	2872	2.1e-42	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Mki67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Mki67	APN	7	135690120	missense	probably benign	0.32
IGL00264:Mki67	APN	7	135707820	nonsense	probably null
IGL00328:Mki67	APN	7	135696695	missense	probably benign	0.03
IGL00570:Mki67	APN	7	135708101	missense	possibly damaging	0.88
IGL00584:Mki67	APN	7	135695695	missense	probably damaging	1.00
IGL00756:Mki67	APN	7	135698731	missense	possibly damaging	0.76
IGL01063:Mki67	APN	7	135694922	missense	possibly damaging	0.93
IGL01112:Mki67	APN	7	135714016	missense	probably damaging	1.00
IGL01360:Mki67	APN	7	135705776	missense	probably damaging	1.00
IGL01457:Mki67	APN	7	135699546	missense	probably benign	0.00
IGL01686:Mki67	APN	7	135707813	missense	probably benign	0.00
IGL01731:Mki67	APN	7	135696549	missense	probably benign	0.03
IGL01775:Mki67	APN	7	135698276	missense	possibly damaging	0.71
IGL01806:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01860:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01938:Mki67	APN	7	135694330	missense	probably benign	0.04
IGL02249:Mki67	APN	7	135700522	missense	possibly damaging	0.47
IGL02260:Mki67	APN	7	135701968	missense	probably benign	0.00
IGL02270:Mki67	APN	7	135698632	missense	probably damaging	1.00
IGL02406:Mki67	APN	7	135698793	missense	probably benign	0.00
IGL02499:Mki67	APN	7	135694327	missense	possibly damaging	0.94
IGL02655:Mki67	APN	7	135714019	missense	probably damaging	0.98
IGL02700:Mki67	APN	7	135708202	missense	probably benign	0.02
IGL03370:Mki67	APN	7	135695490	missense	probably benign	0.00
Advisement	UTSW	7	135698194	missense	probably damaging	1.00
chocotoff	UTSW	7	135698899	missense	possibly damaging	0.92
Godiva	UTSW	7	135701962	missense	probably benign	0.10
sees	UTSW	7	135700915	missense	possibly damaging	0.68
Whitman	UTSW	7	135713865	missense	probably damaging	1.00
BB003:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
BB013:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
PIT4468001:Mki67	UTSW	7	135699147	missense	probably benign	0.00
R0001:Mki67	UTSW	7	135699172	missense	probably damaging	1.00
R0001:Mki67	UTSW	7	135701019	missense	probably damaging	0.99
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0102:Mki67	UTSW	7	135713803	missense	probably benign	0.16
R0130:Mki67	UTSW	7	135696459	missense	probably damaging	1.00
R0149:Mki67	UTSW	7	135698424	missense	probably benign	0.00
R0356:Mki67	UTSW	7	135704406	missense	probably benign	0.34
R0482:Mki67	UTSW	7	135699429	missense	possibly damaging	0.60
R0508:Mki67	UTSW	7	135700346	missense	probably benign
R0532:Mki67	UTSW	7	135698164	nonsense	probably null
R0548:Mki67	UTSW	7	135695256	missense	probably damaging	1.00
R0548:Mki67	UTSW	7	135696908	missense	possibly damaging	0.82
R0557:Mki67	UTSW	7	135699261	missense	possibly damaging	0.48
R0627:Mki67	UTSW	7	135708258	missense	probably benign	0.31
R0631:Mki67	UTSW	7	135704388	missense	probably damaging	0.98
R0848:Mki67	UTSW	7	135701043	missense	probably benign	0.21
R1075:Mki67	UTSW	7	135697311	missense	probably benign	0.03
R1105:Mki67	UTSW	7	135701050	missense	probably benign	0.09
R1272:Mki67	UTSW	7	135700414	nonsense	probably null
R1331:Mki67	UTSW	7	135698276	missense	possibly damaging	0.71
R1486:Mki67	UTSW	7	135699720	missense	probably benign	0.00
R1510:Mki67	UTSW	7	135696171	missense	probably benign	0.26
R1573:Mki67	UTSW	7	135695116	missense	possibly damaging	0.93
R1586:Mki67	UTSW	7	135713972	nonsense	probably null
R1599:Mki67	UTSW	7	135699934	missense	probably benign	0.34
R1623:Mki67	UTSW	7	135708818	splice site	probably null
R1706:Mki67	UTSW	7	135700566	missense	probably benign	0.37
R1718:Mki67	UTSW	7	135695494	missense	probably damaging	1.00
R1785:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R1816:Mki67	UTSW	7	135707387	missense	possibly damaging	0.68
R1862:Mki67	UTSW	7	135699361	missense	probably benign	0.09
R1929:Mki67	UTSW	7	135698065	missense	possibly damaging	0.46
R1957:Mki67	UTSW	7	135698399	missense	probably benign	0.01
R1971:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R1998:Mki67	UTSW	7	135705770	missense	probably benign	0.00
R2004:Mki67	UTSW	7	135698509	nonsense	probably null
R2005:Mki67	UTSW	7	135698509	nonsense	probably null
R2006:Mki67	UTSW	7	135698509	nonsense	probably null
R2109:Mki67	UTSW	7	135697863	missense	probably damaging	1.00
R2130:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2131:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2133:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2140:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2141:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2142:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2284:Mki67	UTSW	7	135699945	missense	probably damaging	0.99
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2913:Mki67	UTSW	7	135700686	missense	possibly damaging	0.71
R3404:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3405:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3406:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3777:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3778:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3787:Mki67	UTSW	7	135700283	missense	possibly damaging	0.93
R3848:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3853:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3971:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3972:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R4258:Mki67	UTSW	7	135695288	missense	possibly damaging	0.86
R4343:Mki67	UTSW	7	135695118	missense	probably benign	0.10
R4488:Mki67	UTSW	7	135697671	missense	probably benign	0.01
R4528:Mki67	UTSW	7	135695359	missense	probably damaging	1.00
R4713:Mki67	UTSW	7	135695469	missense	probably benign	0.35
R4867:Mki67	UTSW	7	135699856	missense	probably damaging	0.97
R4874:Mki67	UTSW	7	135708771	missense	probably damaging	0.97
R4897:Mki67	UTSW	7	135696745	missense	probably damaging	1.00
R5045:Mki67	UTSW	7	135707904	missense	possibly damaging	0.84
R5306:Mki67	UTSW	7	135714001	missense	probably damaging	1.00
R5309:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5312:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5379:Mki67	UTSW	7	135697461	missense	possibly damaging	0.95
R5506:Mki67	UTSW	7	135699981	missense	possibly damaging	0.60
R5513:Mki67	UTSW	7	135707750	missense	probably damaging	0.98
R5742:Mki67	UTSW	7	135704373	missense	probably benign	0.20
R5806:Mki67	UTSW	7	135704605	missense	probably damaging	1.00
R6008:Mki67	UTSW	7	135697429	missense	probably damaging	1.00
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6221:Mki67	UTSW	7	135697914	missense	probably benign	0.18
R6294:Mki67	UTSW	7	135704590	missense	probably benign	0.09
R6377:Mki67	UTSW	7	135696321	missense	possibly damaging	0.67
R6456:Mki67	UTSW	7	135699475	missense	possibly damaging	0.59
R6608:Mki67	UTSW	7	135698361	missense	probably benign	0.01
R6609:Mki67	UTSW	7	135699829	missense	possibly damaging	0.94
R6648:Mki67	UTSW	7	135697440	missense	probably damaging	1.00
R6901:Mki67	UTSW	7	135708760	splice site	probably null
R6978:Mki67	UTSW	7	135701962	missense	probably benign	0.10
R6985:Mki67	UTSW	7	135713865	missense	probably damaging	1.00
R7076:Mki67	UTSW	7	135705629	missense	probably damaging	0.98
R7217:Mki67	UTSW	7	135704182	missense	probably damaging	1.00
R7239:Mki67	UTSW	7	135700176	missense	possibly damaging	0.91
R7250:Mki67	UTSW	7	135699324	missense	possibly damaging	0.90
R7313:Mki67	UTSW	7	135694671	missense	probably benign	0.29
R7336:Mki67	UTSW	7	135713839	missense	probably benign	0.03
R7422:Mki67	UTSW	7	135698370	missense	probably damaging	1.00
R7451:Mki67	UTSW	7	135699351	missense	probably benign	0.01
R7502:Mki67	UTSW	7	135700783	missense	possibly damaging	0.53
R7513:Mki67	UTSW	7	135693223	missense	probably benign
R7578:Mki67	UTSW	7	135700915	missense	possibly damaging	0.68
R7619:Mki67	UTSW	7	135699377	missense	probably benign	0.01
R7646:Mki67	UTSW	7	135696769	missense	possibly damaging	0.63
R7659:Mki67	UTSW	7	135697426	missense	probably damaging	1.00
R7691:Mki67	UTSW	7	135701992	missense	not run
R7780:Mki67	UTSW	7	135713968	missense	probably benign	0.02
R7796:Mki67	UTSW	7	135698194	missense	probably damaging	1.00
R7904:Mki67	UTSW	7	135693087	missense	possibly damaging	0.90
R7911:Mki67	UTSW	7	135704604	missense	probably damaging	1.00
R7921:Mki67	UTSW	7	135695204	missense	probably benign	0.01
R7926:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
R7950:Mki67	UTSW	7	135699724	nonsense	probably null
R8130:Mki67	UTSW	7	135697564	missense	probably damaging	1.00
R8145:Mki67	UTSW	7	135694336	missense	probably benign	0.07
R8196:Mki67	UTSW	7	135695508	missense	probably damaging	1.00
R8220:Mki67	UTSW	7	135698121	missense	probably benign	0.03
R8299:Mki67	UTSW	7	135704620	missense	probably damaging	1.00
R8334:Mki67	UTSW	7	135696516	missense	probably damaging	0.98
R8350:Mki67	UTSW	7	135698471	missense	possibly damaging	0.82
R8358:Mki67	UTSW	7	135700126	missense	possibly damaging	0.46
R8529:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R8698:Mki67	UTSW	7	135695208	missense	possibly damaging	0.87
R8700:Mki67	UTSW	7	135705707	missense
R8737:Mki67	UTSW	7	135713775	missense	probably damaging	1.00
R8914:Mki67	UTSW	7	135697866	missense
R8930:Mki67	UTSW	7	135698899	missense	possibly damaging	0.92
R8932:Mki67	UTSW	7	135698899	missense	possibly damaging	0.92
R8972:Mki67	UTSW	7	135695635	missense	possibly damaging	0.54
R8973:Mki67	UTSW	7	135695635	missense	possibly damaging	0.54
R8975:Mki67	UTSW	7	135695635	missense	possibly damaging	0.54
R8975:Mki67	UTSW	7	135698400	missense	probably benign	0.01
R9071:Mki67	UTSW	7	135699476	missense	probably benign	0.00
R9241:Mki67	UTSW	7	135695924	missense	possibly damaging	0.93
R9387:Mki67	UTSW	7	135700649	missense	probably damaging	0.99
R9524:Mki67	UTSW	7	135704184	missense	probably damaging	1.00
R9565:Mki67	UTSW	7	135707504	frame shift	probably null
R9782:Mki67	UTSW	7	135704337	critical splice donor site	probably null
X0020:Mki67	UTSW	7	135714001	missense	probably damaging	0.96
X0065:Mki67	UTSW	7	135713844	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TTCCCCTGATATTTGTGGATGC -3'
(R):5'- CTCTCCGCTCAGTAAGTCAAG -3'

Sequencing Primer
(F):5'- GATGCATTATGCCTCCTGAAAG -3'
(R):5'- GCTCAGTAAGTCAAGCTGTGCATC -3'

Posted On

2015-04-06