Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Hhip'

277436

Institutional Source

Beutler Lab

Gene Symbol

Hhip

Ensembl Gene

ENSMUSG00000064325

Gene Name

Hedgehog-interacting protein

Synonyms

Hip, Hhip1, Hip1

MMRRC Submission

040895-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79965851-80058006 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79997495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 373 (M373L)

Ref Sequence

ENSEMBL: ENSMUSP00000078047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079038]

AlphaFold

Q7TN16

Predicted Effect

probably benign
Transcript: ENSMUST00000079038
AA Change: M373L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: M373L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Folate_rec	38	220	4.9e-26	PFAM
Pfam:GSDH	226	444	3e-22	PFAM
EGF	593	635	9.63e0	SMART
EGF	638	667	2.35e-2	SMART

Meta Mutation Damage Score

0.0927

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cul9	T	C	17: 46,525,135	Y1195C	probably damaging	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Hhip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01484:Hhip	APN	8	79996783	missense	probably damaging	0.96
IGL02560:Hhip	APN	8	79987009	missense	probably damaging	0.98
IGL03046:Hhip	UTSW	8	79972338	missense	probably damaging	0.99
R0068:Hhip	UTSW	8	79989256	missense	probably damaging	1.00
R0356:Hhip	UTSW	8	79997492	missense	probably benign	0.20
R0707:Hhip	UTSW	8	79998255	missense	probably damaging	1.00
R1163:Hhip	UTSW	8	79992476	missense	probably damaging	1.00
R1583:Hhip	UTSW	8	79990276	missense	probably damaging	1.00
R1900:Hhip	UTSW	8	79975046	missense	probably benign	0.15
R2071:Hhip	UTSW	8	80057302	missense	probably benign	0.00
R2255:Hhip	UTSW	8	80045181	missense	probably damaging	0.98
R4012:Hhip	UTSW	8	79992594	missense	probably damaging	1.00
R4448:Hhip	UTSW	8	80043945	critical splice donor site	probably null
R4607:Hhip	UTSW	8	79997563	missense	probably damaging	0.99
R4608:Hhip	UTSW	8	79997563	missense	probably damaging	0.99
R4677:Hhip	UTSW	8	80045097	missense	probably damaging	0.96
R4738:Hhip	UTSW	8	79992570	missense	probably damaging	0.98
R5040:Hhip	UTSW	8	79997606	missense	probably benign	0.00
R5371:Hhip	UTSW	8	79997591	missense	probably damaging	0.98
R5594:Hhip	UTSW	8	79996863	missense	probably damaging	1.00
R5785:Hhip	UTSW	8	79998192	missense	possibly damaging	0.84
R6026:Hhip	UTSW	8	79972440	missense	probably damaging	1.00
R6259:Hhip	UTSW	8	79972404	missense	probably damaging	1.00
R6782:Hhip	UTSW	8	80051604	missense	probably damaging	1.00
R7105:Hhip	UTSW	8	79975009	missense	probably benign	0.04
R7134:Hhip	UTSW	8	79992513	missense	probably benign
R7238:Hhip	UTSW	8	79987012	missense	probably benign
R7828:Hhip	UTSW	8	79998208	missense	probably benign	0.00
R8418:Hhip	UTSW	8	80045085	missense	probably damaging	0.99
R8814:Hhip	UTSW	8	80051472	missense	probably damaging	1.00
R8947:Hhip	UTSW	8	80045156	missense	probably damaging	0.97
R9101:Hhip	UTSW	8	80043962	missense	probably damaging	1.00
R9163:Hhip	UTSW	8	79975114	missense	probably benign	0.00
R9355:Hhip	UTSW	8	80051604	missense	probably damaging	1.00
R9397:Hhip	UTSW	8	79992483	missense	probably benign
R9673:Hhip	UTSW	8	79992479	missense	probably damaging	1.00
R9685:Hhip	UTSW	8	79996734	missense	probably damaging	1.00
X0026:Hhip	UTSW	8	79992560	missense	possibly damaging	0.93
Z1177:Hhip	UTSW	8	80057251	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTGCAAGGCAGCATTTGTAG -3'
(R):5'- CCAGTGGATTCCTATCACACC -3'

Sequencing Primer
(F):5'- GGCAGCATTTGTAGCAATAATTC -3'
(R):5'- ACCTGCAAAGTCATGGTGCTC -3'

Posted On

2015-04-06