Incidental Mutation 'R3847:Or10d5j'
ID 277438
Institutional Source Beutler Lab
Gene Symbol Or10d5j
Ensembl Gene ENSMUSG00000047352
Gene Name olfactory receptor family 10 subfamily D member 5J
Synonyms GA_x6K02T2PVTD-33657378-33656440, Olfr976, MOR224-10
MMRRC Submission 040895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R3847 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39865553-39872340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39867877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000150494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000216647] [ENSMUST00000217360] [ENSMUST00000217630]
AlphaFold Q8VF15
Predicted Effect probably damaging
Transcript: ENSMUST00000169307
AA Change: M130K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352
AA Change: M130K

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213171
AA Change: M118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216647
Predicted Effect probably damaging
Transcript: ENSMUST00000217360
AA Change: M118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217630
AA Change: M118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,884,190 (GRCm39) probably null Het
Abcc12 C T 8: 87,280,020 (GRCm39) E338K probably benign Het
Abcc5 A T 16: 20,190,906 (GRCm39) S815T probably benign Het
Ankrd16 G A 2: 11,794,619 (GRCm39) E335K probably benign Het
Atm A G 9: 53,414,375 (GRCm39) F905S possibly damaging Het
Bckdha C T 7: 25,331,077 (GRCm39) R281H probably damaging Het
Blvra C T 2: 126,937,111 (GRCm39) T188I probably damaging Het
Bmp8b C A 4: 123,009,961 (GRCm39) probably benign Het
Cacna2d3 A G 14: 29,069,077 (GRCm39) probably null Het
Cacng8 T C 7: 3,442,990 (GRCm39) S84P probably damaging Het
Cad T A 5: 31,218,994 (GRCm39) V605E probably damaging Het
Ccny A G 18: 9,449,641 (GRCm39) S11P probably benign Het
Col3a1 C A 1: 45,361,150 (GRCm39) P112T unknown Het
Corin T C 5: 72,579,508 (GRCm39) E155G probably benign Het
Cul9 T C 17: 46,836,061 (GRCm39) Y1195C probably damaging Het
Cyp27a1 A G 1: 74,776,718 (GRCm39) E501G probably damaging Het
Dennd3 T A 15: 73,414,581 (GRCm39) N457K possibly damaging Het
Dnah7a T G 1: 53,540,815 (GRCm39) I2520L probably benign Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Fgf14 A C 14: 124,217,801 (GRCm39) I234R probably benign Het
Foxp4 A G 17: 48,186,453 (GRCm39) I442T unknown Het
Gad2 T G 2: 22,575,000 (GRCm39) D472E probably benign Het
Garnl3 G T 2: 32,882,240 (GRCm39) H832N probably benign Het
Gm13941 T C 2: 110,935,198 (GRCm39) M11V unknown Het
Gnptab T A 10: 88,269,439 (GRCm39) L714* probably null Het
Golgb1 C A 16: 36,719,095 (GRCm39) Q334K probably benign Het
Gp9 A G 6: 87,756,133 (GRCm39) I49M probably benign Het
Guf1 A G 5: 69,718,500 (GRCm39) N213S probably damaging Het
H2-K2 T G 17: 34,216,303 (GRCm39) H281P probably damaging Het
Hhip T A 8: 80,724,124 (GRCm39) M373L probably benign Het
Ifi203 C T 1: 173,761,362 (GRCm39) C229Y possibly damaging Het
Ighv13-2 A G 12: 114,321,418 (GRCm39) L88S probably damaging Het
Kcna3 T C 3: 106,944,012 (GRCm39) Y92H possibly damaging Het
Lmo7 A G 14: 102,159,531 (GRCm39) probably null Het
Lrguk A G 6: 34,050,703 (GRCm39) D387G probably damaging Het
Mki67 A C 7: 135,297,859 (GRCm39) S2392A probably benign Het
Mknk2 C T 10: 80,503,809 (GRCm39) W367* probably null Het
Mocos A G 18: 24,809,719 (GRCm39) K441E probably damaging Het
Mpnd T C 17: 56,318,692 (GRCm39) S150P probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Neurod4 C T 10: 130,106,351 (GRCm39) V308I probably benign Het
Nxf3 C T X: 134,974,732 (GRCm39) V474I probably benign Het
Or8u10 A T 2: 85,915,751 (GRCm39) Y123* probably null Het
Pam T A 1: 97,782,481 (GRCm39) probably benign Het
Pde5a T C 3: 122,596,809 (GRCm39) Y467H probably damaging Het
Pibf1 T A 14: 99,374,557 (GRCm39) V332E possibly damaging Het
Plxna1 C A 6: 89,333,501 (GRCm39) R376L probably damaging Het
Proz A G 8: 13,123,533 (GRCm39) E268G probably benign Het
Rimbp3 A T 16: 17,028,163 (GRCm39) H529L probably benign Het
Rnf103 C G 6: 71,485,859 (GRCm39) C163W probably damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Septin11 G T 5: 93,310,026 (GRCm39) M276I probably damaging Het
Slc30a4 A G 2: 122,544,192 (GRCm39) V50A probably damaging Het
Sorbs1 A G 19: 40,302,887 (GRCm39) V570A probably damaging Het
Spout1 T C 2: 30,067,419 (GRCm39) probably null Het
Syne2 T C 12: 76,095,396 (GRCm39) L5241P probably damaging Het
Tas2r110 T A 6: 132,845,638 (GRCm39) I223N probably damaging Het
Tead2 T A 7: 44,881,752 (GRCm39) probably null Het
Thsd1 A G 8: 22,749,427 (GRCm39) H713R probably damaging Het
Ttc21b A G 2: 66,073,023 (GRCm39) L221S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r105 A G 17: 20,428,952 (GRCm39) I708T possibly damaging Het
Vmn2r117 G T 17: 23,679,389 (GRCm39) H612N probably damaging Het
Wnk1 C T 6: 119,946,315 (GRCm39) G613S possibly damaging Het
Zbtb41 T A 1: 139,351,734 (GRCm39) H282Q probably benign Het
Zfp335 C A 2: 164,742,026 (GRCm39) probably null Het
Zmym2 T A 14: 57,158,956 (GRCm39) probably benign Het
Other mutations in Or10d5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Or10d5j APN 9 39,867,455 (GRCm39) missense probably damaging 1.00
IGL02455:Or10d5j APN 9 39,868,198 (GRCm39) missense probably damaging 0.96
R1191:Or10d5j UTSW 9 39,868,264 (GRCm39) start codon destroyed probably null 0.02
R1962:Or10d5j UTSW 9 39,867,979 (GRCm39) missense probably benign 0.00
R2328:Or10d5j UTSW 9 39,868,196 (GRCm39) missense possibly damaging 0.95
R4032:Or10d5j UTSW 9 39,867,629 (GRCm39) missense probably benign 0.14
R4620:Or10d5j UTSW 9 39,868,205 (GRCm39) missense probably damaging 1.00
R5152:Or10d5j UTSW 9 39,868,202 (GRCm39) missense probably benign 0.02
R5163:Or10d5j UTSW 9 39,868,216 (GRCm39) missense probably damaging 1.00
R5323:Or10d5j UTSW 9 39,868,125 (GRCm39) nonsense probably null
R5709:Or10d5j UTSW 9 39,867,859 (GRCm39) missense probably damaging 0.98
R7028:Or10d5j UTSW 9 39,867,641 (GRCm39) missense probably benign 0.00
R7085:Or10d5j UTSW 9 39,867,808 (GRCm39) missense probably damaging 1.00
R7723:Or10d5j UTSW 9 39,867,920 (GRCm39) missense possibly damaging 0.92
R8308:Or10d5j UTSW 9 39,868,265 (GRCm39) start codon destroyed probably benign 0.01
R9193:Or10d5j UTSW 9 39,867,878 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGAGGTGTCTGCACATG -3'
(R):5'- CCCATGTATTTCTTCCTGGGGAAC -3'

Sequencing Primer
(F):5'- CAGAAGAAACTGTCTACCTCATTGGG -3'
(R):5'- GAACCTGGCAGTGTTTGACATATTC -3'
Posted On 2015-04-06