Incidental Mutation 'R3847:Atm'
ID277439
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53503075 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 905 (F905S)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118282
AA Change: F905S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: F905S

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000232179
AA Change: F905S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.7132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 splice site probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
bull_run UTSW 9 53487922 missense probably benign 0.09
Civil UTSW 9 53492268 missense possibly damaging 0.78
gettysburg UTSW 9 53455988 splice site probably null
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
thrasher UTSW 9 53445507 missense probably benign 0.01
Tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 splice site probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 splice site probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
R8221:Atm UTSW 9 53455988 splice site probably null
R8247:Atm UTSW 9 53450570 missense
R8334:Atm UTSW 9 53522273 missense probably benign 0.00
R8503:Atm UTSW 9 53488052 missense probably damaging 0.99
R8552:Atm UTSW 9 53524497 missense probably damaging 1.00
R8749:Atm UTSW 9 53499197 nonsense probably null
R8838:Atm UTSW 9 53516551 missense probably damaging 0.99
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTGTACTCGGTGAGACTG -3'
(R):5'- CTAAAGGCTAGGTTATTTGAACTTTGG -3'

Sequencing Primer
(F):5'- TACTCGGTGAGACTGCTTCAGC -3'
(R):5'- TTTGAACTTTGGAAAGCTGGAAAGC -3'
Posted On2015-04-06