Incidental Mutation 'R3847:Neurod4'
ID277442
Institutional Source Beutler Lab
Gene Symbol Neurod4
Ensembl Gene ENSMUSG00000048015
Gene Nameneurogenic differentiation 4
SynonymsbHLHa4, MATH-3, Atoh3, Math3
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130268152-130280240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130270482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 308 (V308I)
Ref Sequence ENSEMBL: ENSMUSP00000051379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061571]
Predicted Effect probably benign
Transcript: ENSMUST00000061571
AA Change: V308I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051379
Gene: ENSMUSG00000048015
AA Change: V308I

DomainStartEndE-ValueType
low complexity region 49 76 N/A INTRINSIC
HLH 93 145 2.21e-16 SMART
Pfam:Neuro_bHLH 146 263 1.3e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene belongs to the neurogenic differentiation factor family and encodes a basic helix-loop-helix (bHLH) transcription factor which is expressed in the developing nervous system with high levels of expression in the brain, retina and cranial ganglions. Expression gradually becomes restricted to the neural retina. It is a key gene in the Ngn2-regulated neuronal differentiation pathway, coordinating the onset of cortical gene transcription. This gene also regulates amacrine cell fate determination in the retina. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, ataxia, and high postnatal mortality. Mutants show impaired postnatal cerebellar development, with thinner inner granular cell and molecular layers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Neurod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Neurod4 APN 10 130270814 missense probably damaging 0.96
IGL01674:Neurod4 APN 10 130271018 missense probably damaging 1.00
R0347:Neurod4 UTSW 10 130271111 missense probably damaging 1.00
R1436:Neurod4 UTSW 10 130270671 missense possibly damaging 0.87
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1965:Neurod4 UTSW 10 130271049 nonsense probably null
R3018:Neurod4 UTSW 10 130270955 missense probably damaging 1.00
R5491:Neurod4 UTSW 10 130271067 missense possibly damaging 0.95
R5655:Neurod4 UTSW 10 130271133 nonsense probably null
R5705:Neurod4 UTSW 10 130271402 start codon destroyed probably null 0.99
R6143:Neurod4 UTSW 10 130271000 missense probably damaging 1.00
R6800:Neurod4 UTSW 10 130270792 nonsense probably null
R6867:Neurod4 UTSW 10 130270714 missense probably damaging 1.00
R7396:Neurod4 UTSW 10 130271022 missense probably damaging 1.00
R7401:Neurod4 UTSW 10 130271058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTACAGGAAGTTCTGAACAAAC -3'
(R):5'- ATCCACCTGACTGCAGTACC -3'

Sequencing Primer
(F):5'- TGTTTGATGCATATCCAAAGGTTC -3'
(R):5'- GCTCCCCTGATTTGGAAA -3'
Posted On2015-04-06