Incidental Mutation 'R3847:Fgf14'
ID277451
Institutional Source Beutler Lab
Gene Symbol Fgf14
Ensembl Gene ENSMUSG00000025551
Gene Namefibroblast growth factor 14
SynonymsFhf4
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location123977907-124677127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123980389 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 234 (I234R)
Ref Sequence ENSEMBL: ENSMUSP00000026631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026631] [ENSMUST00000049681] [ENSMUST00000095529] [ENSMUST00000132026]
Predicted Effect probably benign
Transcript: ENSMUST00000026631
AA Change: I234R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026631
Gene: ENSMUSG00000025551
AA Change: I234R

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
FGF 69 200 1.75e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049681
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000095529
AA Change: I239R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000093185
Gene: ENSMUSG00000025551
AA Change: I239R

DomainStartEndE-ValueType
FGF 74 205 1.75e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117453
Predicted Effect probably benign
Transcript: ENSMUST00000132026
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186300
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display impaired balance and grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Fgf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Fgf14 APN 14 123980372 missense possibly damaging 0.51
IGL02733:Fgf14 APN 14 123983801 missense probably damaging 1.00
IGL02939:Fgf14 APN 14 124132479 missense possibly damaging 0.82
R0517:Fgf14 UTSW 14 123983784 missense probably damaging 1.00
R0608:Fgf14 UTSW 14 124676603 missense probably damaging 0.99
R1034:Fgf14 UTSW 14 124132534 missense probably damaging 0.96
R1183:Fgf14 UTSW 14 124676524 missense probably benign 0.03
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1584:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1768:Fgf14 UTSW 14 124676512 missense probably benign 0.00
R2190:Fgf14 UTSW 14 123983918 missense probably damaging 1.00
R2307:Fgf14 UTSW 14 123983822 missense probably damaging 1.00
R3743:Fgf14 UTSW 14 124676620 missense probably benign
R4859:Fgf14 UTSW 14 124192433 missense possibly damaging 0.78
R5529:Fgf14 UTSW 14 123980455 missense probably damaging 1.00
R5655:Fgf14 UTSW 14 124192416 missense probably benign
R6242:Fgf14 UTSW 14 124676528 missense probably benign 0.02
R6958:Fgf14 UTSW 14 124676597 missense probably benign
R7460:Fgf14 UTSW 14 124676693 missense possibly damaging 0.92
R7726:Fgf14 UTSW 14 124136244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGACAGCATAAGACAAGC -3'
(R):5'- CTGCCTTAAAGCTGCTGTCC -3'

Sequencing Primer
(F):5'- CTGAGACAGCATAAGACAAGCATCAG -3'
(R):5'- AAAGCTGCTGTCCTGTTATCAATGG -3'
Posted On2015-04-06