Incidental Mutation 'R3847:Vmn2r105'
ID 277457
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Name vomeronasal 2, receptor 105
Synonyms EG627743
MMRRC Submission 040895-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3847 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20428492-20455134 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20428952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 708 (I708T)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
AlphaFold E9Q3A5
Predicted Effect possibly damaging
Transcript: ENSMUST00000167382
AA Change: I708T

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: I708T

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,884,190 (GRCm39) probably null Het
Abcc12 C T 8: 87,280,020 (GRCm39) E338K probably benign Het
Abcc5 A T 16: 20,190,906 (GRCm39) S815T probably benign Het
Ankrd16 G A 2: 11,794,619 (GRCm39) E335K probably benign Het
Atm A G 9: 53,414,375 (GRCm39) F905S possibly damaging Het
Bckdha C T 7: 25,331,077 (GRCm39) R281H probably damaging Het
Blvra C T 2: 126,937,111 (GRCm39) T188I probably damaging Het
Bmp8b C A 4: 123,009,961 (GRCm39) probably benign Het
Cacna2d3 A G 14: 29,069,077 (GRCm39) probably null Het
Cacng8 T C 7: 3,442,990 (GRCm39) S84P probably damaging Het
Cad T A 5: 31,218,994 (GRCm39) V605E probably damaging Het
Ccny A G 18: 9,449,641 (GRCm39) S11P probably benign Het
Col3a1 C A 1: 45,361,150 (GRCm39) P112T unknown Het
Corin T C 5: 72,579,508 (GRCm39) E155G probably benign Het
Cul9 T C 17: 46,836,061 (GRCm39) Y1195C probably damaging Het
Cyp27a1 A G 1: 74,776,718 (GRCm39) E501G probably damaging Het
Dennd3 T A 15: 73,414,581 (GRCm39) N457K possibly damaging Het
Dnah7a T G 1: 53,540,815 (GRCm39) I2520L probably benign Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Fgf14 A C 14: 124,217,801 (GRCm39) I234R probably benign Het
Foxp4 A G 17: 48,186,453 (GRCm39) I442T unknown Het
Gad2 T G 2: 22,575,000 (GRCm39) D472E probably benign Het
Garnl3 G T 2: 32,882,240 (GRCm39) H832N probably benign Het
Gm13941 T C 2: 110,935,198 (GRCm39) M11V unknown Het
Gnptab T A 10: 88,269,439 (GRCm39) L714* probably null Het
Golgb1 C A 16: 36,719,095 (GRCm39) Q334K probably benign Het
Gp9 A G 6: 87,756,133 (GRCm39) I49M probably benign Het
Guf1 A G 5: 69,718,500 (GRCm39) N213S probably damaging Het
H2-K2 T G 17: 34,216,303 (GRCm39) H281P probably damaging Het
Hhip T A 8: 80,724,124 (GRCm39) M373L probably benign Het
Ifi203 C T 1: 173,761,362 (GRCm39) C229Y possibly damaging Het
Ighv13-2 A G 12: 114,321,418 (GRCm39) L88S probably damaging Het
Kcna3 T C 3: 106,944,012 (GRCm39) Y92H possibly damaging Het
Lmo7 A G 14: 102,159,531 (GRCm39) probably null Het
Lrguk A G 6: 34,050,703 (GRCm39) D387G probably damaging Het
Mki67 A C 7: 135,297,859 (GRCm39) S2392A probably benign Het
Mknk2 C T 10: 80,503,809 (GRCm39) W367* probably null Het
Mocos A G 18: 24,809,719 (GRCm39) K441E probably damaging Het
Mpnd T C 17: 56,318,692 (GRCm39) S150P probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Neurod4 C T 10: 130,106,351 (GRCm39) V308I probably benign Het
Nxf3 C T X: 134,974,732 (GRCm39) V474I probably benign Het
Or10d5j A T 9: 39,867,877 (GRCm39) M118K probably damaging Het
Or8u10 A T 2: 85,915,751 (GRCm39) Y123* probably null Het
Pam T A 1: 97,782,481 (GRCm39) probably benign Het
Pde5a T C 3: 122,596,809 (GRCm39) Y467H probably damaging Het
Pibf1 T A 14: 99,374,557 (GRCm39) V332E possibly damaging Het
Plxna1 C A 6: 89,333,501 (GRCm39) R376L probably damaging Het
Proz A G 8: 13,123,533 (GRCm39) E268G probably benign Het
Rimbp3 A T 16: 17,028,163 (GRCm39) H529L probably benign Het
Rnf103 C G 6: 71,485,859 (GRCm39) C163W probably damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Septin11 G T 5: 93,310,026 (GRCm39) M276I probably damaging Het
Slc30a4 A G 2: 122,544,192 (GRCm39) V50A probably damaging Het
Sorbs1 A G 19: 40,302,887 (GRCm39) V570A probably damaging Het
Spout1 T C 2: 30,067,419 (GRCm39) probably null Het
Syne2 T C 12: 76,095,396 (GRCm39) L5241P probably damaging Het
Tas2r110 T A 6: 132,845,638 (GRCm39) I223N probably damaging Het
Tead2 T A 7: 44,881,752 (GRCm39) probably null Het
Thsd1 A G 8: 22,749,427 (GRCm39) H713R probably damaging Het
Ttc21b A G 2: 66,073,023 (GRCm39) L221S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r117 G T 17: 23,679,389 (GRCm39) H612N probably damaging Het
Wnk1 C T 6: 119,946,315 (GRCm39) G613S possibly damaging Het
Zbtb41 T A 1: 139,351,734 (GRCm39) H282Q probably benign Het
Zfp335 C A 2: 164,742,026 (GRCm39) probably null Het
Zmym2 T A 14: 57,158,956 (GRCm39) probably benign Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20,448,817 (GRCm39) missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20,444,918 (GRCm39) missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20,428,973 (GRCm39) missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20,448,157 (GRCm39) missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20,429,345 (GRCm39) missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20,447,847 (GRCm39) missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20,446,631 (GRCm39) nonsense probably null
R0096:Vmn2r105 UTSW 17 20,447,741 (GRCm39) missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20,447,741 (GRCm39) missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20,428,827 (GRCm39) missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20,428,938 (GRCm39) missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20,454,965 (GRCm39) missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20,428,578 (GRCm39) missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20,448,119 (GRCm39) missense probably damaging 0.98
R0765:Vmn2r105 UTSW 17 20,447,973 (GRCm39) missense probably benign 0.20
R1162:Vmn2r105 UTSW 17 20,447,973 (GRCm39) missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20,428,584 (GRCm39) missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20,428,932 (GRCm39) missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20,449,004 (GRCm39) splice site probably benign
R2029:Vmn2r105 UTSW 17 20,444,840 (GRCm39) missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20,447,585 (GRCm39) missense probably damaging 1.00
R3848:Vmn2r105 UTSW 17 20,428,952 (GRCm39) missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20,429,016 (GRCm39) missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20,448,902 (GRCm39) missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20,446,613 (GRCm39) missense probably benign
R4801:Vmn2r105 UTSW 17 20,447,556 (GRCm39) missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20,447,556 (GRCm39) missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20,428,953 (GRCm39) missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20,448,280 (GRCm39) missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20,428,676 (GRCm39) missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20,455,044 (GRCm39) missense probably benign
R5576:Vmn2r105 UTSW 17 20,444,836 (GRCm39) critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20,448,998 (GRCm39) missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20,448,929 (GRCm39) missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20,428,889 (GRCm39) missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20,448,758 (GRCm39) missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20,447,992 (GRCm39) nonsense probably null
R6542:Vmn2r105 UTSW 17 20,448,803 (GRCm39) missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20,428,605 (GRCm39) missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20,429,336 (GRCm39) missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20,428,874 (GRCm39) missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20,429,045 (GRCm39) missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20,448,827 (GRCm39) missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20,447,937 (GRCm39) missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20,428,937 (GRCm39) missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20,454,966 (GRCm39) missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20,428,904 (GRCm39) missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20,444,880 (GRCm39) nonsense probably null
R8214:Vmn2r105 UTSW 17 20,448,775 (GRCm39) missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20,455,134 (GRCm39) start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20,428,872 (GRCm39) missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20,429,229 (GRCm39) missense probably damaging 0.99
R9272:Vmn2r105 UTSW 17 20,447,685 (GRCm39) missense probably damaging 1.00
R9506:Vmn2r105 UTSW 17 20,429,404 (GRCm39) missense probably benign 0.00
R9549:Vmn2r105 UTSW 17 20,448,023 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCAGCAAGCTGAATGACAG -3'
(R):5'- TCCTGCAGCAGACCACATTTG -3'

Sequencing Primer
(F):5'- TTCTAGATAAGAAGGCCACGGTG -3'
(R):5'- CACATTTGGAGTTGCATTCACTG -3'
Posted On 2015-04-06