Incidental Mutation 'R3847:Vmn2r117'
ID 277458
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788, V2Rp6
MMRRC Submission 040895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R3847 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 23678649-23698571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 23679389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 612 (H612N)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: H612N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: H612N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,884,190 (GRCm39) probably null Het
Abcc12 C T 8: 87,280,020 (GRCm39) E338K probably benign Het
Abcc5 A T 16: 20,190,906 (GRCm39) S815T probably benign Het
Ankrd16 G A 2: 11,794,619 (GRCm39) E335K probably benign Het
Atm A G 9: 53,414,375 (GRCm39) F905S possibly damaging Het
Bckdha C T 7: 25,331,077 (GRCm39) R281H probably damaging Het
Blvra C T 2: 126,937,111 (GRCm39) T188I probably damaging Het
Bmp8b C A 4: 123,009,961 (GRCm39) probably benign Het
Cacna2d3 A G 14: 29,069,077 (GRCm39) probably null Het
Cacng8 T C 7: 3,442,990 (GRCm39) S84P probably damaging Het
Cad T A 5: 31,218,994 (GRCm39) V605E probably damaging Het
Ccny A G 18: 9,449,641 (GRCm39) S11P probably benign Het
Col3a1 C A 1: 45,361,150 (GRCm39) P112T unknown Het
Corin T C 5: 72,579,508 (GRCm39) E155G probably benign Het
Cul9 T C 17: 46,836,061 (GRCm39) Y1195C probably damaging Het
Cyp27a1 A G 1: 74,776,718 (GRCm39) E501G probably damaging Het
Dennd3 T A 15: 73,414,581 (GRCm39) N457K possibly damaging Het
Dnah7a T G 1: 53,540,815 (GRCm39) I2520L probably benign Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Fgf14 A C 14: 124,217,801 (GRCm39) I234R probably benign Het
Foxp4 A G 17: 48,186,453 (GRCm39) I442T unknown Het
Gad2 T G 2: 22,575,000 (GRCm39) D472E probably benign Het
Garnl3 G T 2: 32,882,240 (GRCm39) H832N probably benign Het
Gm13941 T C 2: 110,935,198 (GRCm39) M11V unknown Het
Gnptab T A 10: 88,269,439 (GRCm39) L714* probably null Het
Golgb1 C A 16: 36,719,095 (GRCm39) Q334K probably benign Het
Gp9 A G 6: 87,756,133 (GRCm39) I49M probably benign Het
Guf1 A G 5: 69,718,500 (GRCm39) N213S probably damaging Het
H2-K2 T G 17: 34,216,303 (GRCm39) H281P probably damaging Het
Hhip T A 8: 80,724,124 (GRCm39) M373L probably benign Het
Ifi203 C T 1: 173,761,362 (GRCm39) C229Y possibly damaging Het
Ighv13-2 A G 12: 114,321,418 (GRCm39) L88S probably damaging Het
Kcna3 T C 3: 106,944,012 (GRCm39) Y92H possibly damaging Het
Lmo7 A G 14: 102,159,531 (GRCm39) probably null Het
Lrguk A G 6: 34,050,703 (GRCm39) D387G probably damaging Het
Mki67 A C 7: 135,297,859 (GRCm39) S2392A probably benign Het
Mknk2 C T 10: 80,503,809 (GRCm39) W367* probably null Het
Mocos A G 18: 24,809,719 (GRCm39) K441E probably damaging Het
Mpnd T C 17: 56,318,692 (GRCm39) S150P probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Neurod4 C T 10: 130,106,351 (GRCm39) V308I probably benign Het
Nxf3 C T X: 134,974,732 (GRCm39) V474I probably benign Het
Or10d5j A T 9: 39,867,877 (GRCm39) M118K probably damaging Het
Or8u10 A T 2: 85,915,751 (GRCm39) Y123* probably null Het
Pam T A 1: 97,782,481 (GRCm39) probably benign Het
Pde5a T C 3: 122,596,809 (GRCm39) Y467H probably damaging Het
Pibf1 T A 14: 99,374,557 (GRCm39) V332E possibly damaging Het
Plxna1 C A 6: 89,333,501 (GRCm39) R376L probably damaging Het
Proz A G 8: 13,123,533 (GRCm39) E268G probably benign Het
Rimbp3 A T 16: 17,028,163 (GRCm39) H529L probably benign Het
Rnf103 C G 6: 71,485,859 (GRCm39) C163W probably damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Septin11 G T 5: 93,310,026 (GRCm39) M276I probably damaging Het
Slc30a4 A G 2: 122,544,192 (GRCm39) V50A probably damaging Het
Sorbs1 A G 19: 40,302,887 (GRCm39) V570A probably damaging Het
Spout1 T C 2: 30,067,419 (GRCm39) probably null Het
Syne2 T C 12: 76,095,396 (GRCm39) L5241P probably damaging Het
Tas2r110 T A 6: 132,845,638 (GRCm39) I223N probably damaging Het
Tead2 T A 7: 44,881,752 (GRCm39) probably null Het
Thsd1 A G 8: 22,749,427 (GRCm39) H713R probably damaging Het
Ttc21b A G 2: 66,073,023 (GRCm39) L221S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r105 A G 17: 20,428,952 (GRCm39) I708T possibly damaging Het
Wnk1 C T 6: 119,946,315 (GRCm39) G613S possibly damaging Het
Zbtb41 T A 1: 139,351,734 (GRCm39) H282Q probably benign Het
Zfp335 C A 2: 164,742,026 (GRCm39) probably null Het
Zmym2 T A 14: 57,158,956 (GRCm39) probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23,698,520 (GRCm39) missense probably benign
IGL00990:Vmn2r117 APN 17 23,696,814 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23,694,403 (GRCm39) missense probably damaging 1.00
IGL01078:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23,697,356 (GRCm39) missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23,696,215 (GRCm39) missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23,694,356 (GRCm39) missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23,696,199 (GRCm39) missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23,678,758 (GRCm39) missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23,694,552 (GRCm39) splice site probably benign
IGL03167:Vmn2r117 APN 17 23,696,681 (GRCm39) missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23,679,139 (GRCm39) missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23,694,488 (GRCm39) missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23,694,477 (GRCm39) nonsense probably null
R1411:Vmn2r117 UTSW 17 23,679,527 (GRCm39) missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23,697,447 (GRCm39) missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23,696,429 (GRCm39) missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23,697,363 (GRCm39) missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23,696,454 (GRCm39) missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23,696,618 (GRCm39) missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23,679,230 (GRCm39) missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23,678,885 (GRCm39) missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3848:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23,679,080 (GRCm39) missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R4560:Vmn2r117 UTSW 17 23,678,851 (GRCm39) missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23,697,390 (GRCm39) missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23,696,859 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23,678,812 (GRCm39) missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R5078:Vmn2r117 UTSW 17 23,679,122 (GRCm39) missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23,696,848 (GRCm39) nonsense probably null
R5774:Vmn2r117 UTSW 17 23,696,176 (GRCm39) missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23,698,535 (GRCm39) missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23,679,088 (GRCm39) missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23,679,193 (GRCm39) missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23,679,023 (GRCm39) nonsense probably null
R6736:Vmn2r117 UTSW 17 23,697,282 (GRCm39) missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23,698,537 (GRCm39) missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23,696,177 (GRCm39) missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23,694,359 (GRCm39) missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23,694,539 (GRCm39) missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23,679,319 (GRCm39) missense probably damaging 1.00
R7443:Vmn2r117 UTSW 17 23,679,107 (GRCm39) missense probably benign 0.25
R7449:Vmn2r117 UTSW 17 23,678,869 (GRCm39) missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23,696,265 (GRCm39) missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23,679,100 (GRCm39) missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23,698,381 (GRCm39) missense possibly damaging 0.89
R8029:Vmn2r117 UTSW 17 23,696,744 (GRCm39) missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23,679,511 (GRCm39) missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23,698,442 (GRCm39) missense probably benign
R8723:Vmn2r117 UTSW 17 23,696,343 (GRCm39) missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23,679,143 (GRCm39) missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23,679,445 (GRCm39) missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23,678,918 (GRCm39) nonsense probably null
R9244:Vmn2r117 UTSW 17 23,696,589 (GRCm39) missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23,696,578 (GRCm39) missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23,697,450 (GRCm39) missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
V5622:Vmn2r117 UTSW 17 23,696,814 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r117 UTSW 17 23,678,740 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTGATTTTGAATGCCAGAAC -3'
(R):5'- CCCATTAGATGTGGATTATTGTGTC -3'

Sequencing Primer
(F):5'- ATCGTTTTAGCCAAGACAGTGG -3'
(R):5'- AGATGTGGATTATTGTGTCCAGTGTC -3'
Posted On 2015-04-06