Incidental Mutation 'R3847:Vmn2r117'
ID 277458
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R3847 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 23459675-23479597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 23460415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 612 (H612N)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: H612N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: H612N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23477840 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23475429 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23479546 missense probably benign
IGL01078:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23478382 missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23477241 missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23475382 missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23477225 missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23459784 missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23475578 splice site probably benign
IGL03167:Vmn2r117 APN 17 23477707 missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23460165 missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23475514 missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23475503 nonsense probably null
R1411:Vmn2r117 UTSW 17 23460553 missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23478473 missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23477455 missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23478389 missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23477480 missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23477644 missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23460256 missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23459911 missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3848:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23460106 missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23479513 frame shift probably null
R4560:Vmn2r117 UTSW 17 23459877 missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23478416 missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23477885 missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23459838 missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23479513 frame shift probably null
R5078:Vmn2r117 UTSW 17 23460148 missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23477874 nonsense probably null
R5774:Vmn2r117 UTSW 17 23477202 missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23479561 missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23460114 missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23460219 missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23460049 nonsense probably null
R6736:Vmn2r117 UTSW 17 23478308 missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23479563 missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23477203 missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23475385 missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23475565 missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23460133 missense probably benign 0.25
R7443:Vmn2r117 UTSW 17 23460345 missense probably damaging 1.00
R7449:Vmn2r117 UTSW 17 23459895 missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23477291 missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23460126 missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23479407 missense possibly damaging 0.89
R8029:Vmn2r117 UTSW 17 23477770 missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23460537 missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23479468 missense probably benign
R8723:Vmn2r117 UTSW 17 23477369 missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23460169 missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23460471 missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23459944 nonsense probably null
R9244:Vmn2r117 UTSW 17 23477615 missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23477604 missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23478476 missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23477840 missense probably damaging 1.00
V5622:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
Z1176:Vmn2r117 UTSW 17 23459766 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTGATTTTGAATGCCAGAAC -3'
(R):5'- CCCATTAGATGTGGATTATTGTGTC -3'

Sequencing Primer
(F):5'- ATCGTTTTAGCCAAGACAGTGG -3'
(R):5'- AGATGTGGATTATTGTGTCCAGTGTC -3'
Posted On 2015-04-06