Incidental Mutation 'R3847:H2-K1'
ID277459
Institutional Source Beutler Lab
Gene Symbol H2-K1
Ensembl Gene ENSMUSG00000061232
Gene Namehistocompatibility 2, K1, K region
SynonymsH-2K
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3847 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33996017-34000333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33997329 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 281 (H281P)
Ref Sequence ENSEMBL: ENSMUSP00000025181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025181] [ENSMUST00000087189] [ENSMUST00000172912] [ENSMUST00000173075]
PDB Structure
MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION]
MURINE ALLOREACTIVE SCFV TCR-PEPTIDE-MHC CLASS I MOLECULE COMPLEX [X-RAY DIFFRACTION]
MHC CLASS I NATURAL MUTANT H-2KBM1 HEAVY CHAIN COMPLEXED WITH BETA-2 MICROGLOBULIN AND VESICULAR STOMATITIS VIRUS NUCLEOPROTEIN [X-RAY DIFFRACTION]
MHC CLASS I NATURAL MUTANT H-2KBM1 HEAVY CHAIN COMPLEXED WITH BETA-2 MICROGLOBULIN AND SENDAI VIRUS NUCLEOPROTEIN [X-RAY DIFFRACTION]
MHC CLASS I NATURAL MUTANT H-2KBM8 HEAVY CHAIN COMPLEXED WITH BETA-2 MICROGLOBULIN AND VESICULAR STOMATITIS VIRUS NUCLEOPROTEIN [X-RAY DIFFRACTION]
MHC CLASS I NATURAL MUTANT H-2KBM8 HEAVY CHAIN COMPLEXED WITH BETA-2 MICROGLOBULIN AND SENDAI VIRUS NUCLEOPROTEIN [X-RAY DIFFRACTION]
A FUNCTIONAL HOT SPOT FOR ANTIGEN RECOGNITION IN A SUPERAGONIST TCR/MHC COMPLEX [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MHC CLASS I H-2KB HEAVY CHAIN COMPLEXED WITH BETA-2 MICROGLOBULIN AND YEAST ALPHA-GLUCOSIDASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MHC CLASS I H-2KB HEAVY CHAIN COMPLEXED WITH BETA-2 MICROGLOBULIN AND MUC1 VNTR PEPTIDE SAPDTRPA [X-RAY DIFFRACTION]
MHC Class I H-2KB Presented Glycopeptide RGY8-6H-GAL2 [X-RAY DIFFRACTION]
>> 62 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000025181
AA Change: H281P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025181
Gene: ENSMUSG00000061232
AA Change: H281P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.4e-95 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 335 359 2.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087189
AA Change: H99P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084436
Gene: ENSMUSG00000061232
AA Change: H99P

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
IGc1 37 108 9.98e-22 SMART
low complexity region 124 143 N/A INTRINSIC
Pfam:MHC_I_C 152 177 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172782
Predicted Effect probably damaging
Transcript: ENSMUST00000172912
AA Change: H281P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134004
Gene: ENSMUSG00000061232
AA Change: H281P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.7e-97 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 334 359 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173075
SMART Domains Protein: ENSMUSP00000133847
Gene: ENSMUSG00000061232

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 42 220 3.7e-97 PFAM
Pfam:C1-set 229 289 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173602
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display T-cell abnormalities and abnormal susceptibility to various viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in H2-K1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:H2-K1 APN 17 33999492 missense probably damaging 1.00
FR4548:H2-K1 UTSW 17 33997042 unclassified probably benign
FR4976:H2-K1 UTSW 17 33997042 unclassified probably benign
R0254:H2-K1 UTSW 17 33996665 unclassified probably benign
R0520:H2-K1 UTSW 17 33997416 missense probably damaging 1.00
R0540:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R0607:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R1282:H2-K1 UTSW 17 33999447 missense probably damaging 1.00
R1785:H2-K1 UTSW 17 33997348 nonsense probably null
R2307:H2-K1 UTSW 17 33997139 missense probably benign 0.26
R3791:H2-K1 UTSW 17 33999525 missense probably benign 0.02
R4008:H2-K1 UTSW 17 33999551 splice site probably benign
R4324:H2-K1 UTSW 17 34000040 missense possibly damaging 0.76
R4470:H2-K1 UTSW 17 34000061 missense probably benign 0.20
R4543:H2-K1 UTSW 17 33999558 splice site probably null
R4858:H2-K1 UTSW 17 33997324 missense probably benign 0.05
R4921:H2-K1 UTSW 17 33997076 missense possibly damaging 0.65
R5254:H2-K1 UTSW 17 33997462 missense probably damaging 1.00
R5269:H2-K1 UTSW 17 33997015 unclassified probably benign
R6058:H2-K1 UTSW 17 33999330 missense probably benign 0.02
R6058:H2-K1 UTSW 17 33999331 missense probably benign
R8057:H2-K1 UTSW 17 33996859 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCGCCATGTTGGAGACAGTG -3'
(R):5'- CAGACCTGAAGATAAAGTCACCCTG -3'

Sequencing Primer
(F):5'- CCATGTTGGAGACAGTGGATGG -3'
(R):5'- TGAGGTGCTGGGCCCTG -3'
Posted On2015-04-06