Mutagenetix > Incidental Mutation

Incidental Mutation 'R3847:Cul9'

277460

Institutional Source

Beutler Lab

Gene Symbol

Cul9

Ensembl Gene

ENSMUSG00000040327

Gene Name

cullin 9

Synonyms

1810035I07Rik, Parc

MMRRC Submission

040895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R3847 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46500572-46546388 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46525135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1195 (Y1195C)

Ref Sequence

ENSEMBL: ENSMUSP00000138418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000066026
AA Change: Y1195C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: Y1195C

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	441	1e-35	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	2e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
low complexity region	2503	2520	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182315

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182451

Predicted Effect

probably damaging
Transcript: ENSMUST00000182485
AA Change: Y1195C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: Y1195C

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	442	1.4e-33	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	3e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
coiled coil region	2461	2497	N/A	INTRINSIC
low complexity region	2513	2530	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182530

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182799

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183016

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183163

Meta Mutation Damage Score

0.6024

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,736,324		probably null	Het
Abcc12	C	T	8: 86,553,391	E338K	probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Ankrd16	G	A	2: 11,789,808	E335K	probably benign	Het
Atm	A	G	9: 53,503,075	F905S	possibly damaging	Het
Bckdha	C	T	7: 25,631,652	R281H	probably damaging	Het
Blvra	C	T	2: 127,095,191	T188I	probably damaging	Het
Bmp8b	C	A	4: 123,116,168		probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cacng8	T	C	7: 3,394,474	S84P	probably damaging	Het
Cad	T	A	5: 31,061,650	V605E	probably damaging	Het
Ccny	A	G	18: 9,449,641	S11P	probably benign	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Corin	T	C	5: 72,422,165	E155G	probably benign	Het
Cyp27a1	A	G	1: 74,737,559	E501G	probably damaging	Het
Dennd3	T	A	15: 73,542,732	N457K	possibly damaging	Het
Dnah7a	T	G	1: 53,501,656	I2520L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fgf14	A	C	14: 123,980,389	I234R	probably benign	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gad2	T	G	2: 22,684,988	D472E	probably benign	Het
Garnl3	G	T	2: 32,992,228	H832N	probably benign	Het
Gm13941	T	C	2: 111,104,853	M11V	unknown	Het
Gnptab	T	A	10: 88,433,577	L714*	probably null	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Guf1	A	G	5: 69,561,157	N213S	probably damaging	Het
H2-K1	T	G	17: 33,997,329	H281P	probably damaging	Het
Hhip	T	A	8: 79,997,495	M373L	probably benign	Het
Ifi203	C	T	1: 173,933,796	C229Y	possibly damaging	Het
Ighv13-2	A	G	12: 114,357,798	L88S	probably damaging	Het
Kcna3	T	C	3: 107,036,696	Y92H	possibly damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mknk2	C	T	10: 80,667,975	W367*	probably null	Het
Mocos	A	G	18: 24,676,662	K441E	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Neurod4	C	T	10: 130,270,482	V308I	probably benign	Het
Nxf3	C	T	X: 136,073,983	V474I	probably benign	Het
Olfr1037	A	T	2: 86,085,407	Y123*	probably null	Het
Olfr976	A	T	9: 39,956,581	M118K	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Pde5a	T	C	3: 122,803,160	Y467H	probably damaging	Het
Pibf1	T	A	14: 99,137,121	V332E	possibly damaging	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Sept11	G	T	5: 93,162,167	M276I	probably damaging	Het
Slc30a4	A	G	2: 122,702,272	V50A	probably damaging	Het
Sorbs1	A	G	19: 40,314,443	V570A	probably damaging	Het
Spout1	T	C	2: 30,177,407		probably null	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thsd1	A	G	8: 22,259,411	H713R	probably damaging	Het
Ttc21b	A	G	2: 66,242,679	L221S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r105	A	G	17: 20,208,690	I708T	possibly damaging	Het
Vmn2r117	G	T	17: 23,460,415	H612N	probably damaging	Het
Wnk1	C	T	6: 119,969,354	G613S	possibly damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het
Zfp335	C	A	2: 164,900,106		probably null	Het
Zmym2	T	A	14: 56,921,499		probably benign	Het

Other mutations in Cul9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Cul9	APN	17	46525709	missense	probably damaging	1.00
IGL00330:Cul9	APN	17	46510841	splice site	probably benign
IGL00726:Cul9	APN	17	46528096	missense	probably damaging	1.00
IGL01020:Cul9	APN	17	46539023	missense	probably damaging	1.00
IGL01358:Cul9	APN	17	46538314	missense	probably damaging	1.00
IGL01410:Cul9	APN	17	46528646	missense	probably damaging	0.99
IGL01781:Cul9	APN	17	46539304	missense	probably benign
IGL01873:Cul9	APN	17	46502452	missense	probably damaging	0.99
IGL02117:Cul9	APN	17	46540375	missense	probably benign	0.00
IGL02300:Cul9	APN	17	46521032	splice site	probably benign
IGL02426:Cul9	APN	17	46523258	missense	possibly damaging	0.95
IGL02427:Cul9	APN	17	46502632	missense	possibly damaging	0.69
IGL02496:Cul9	APN	17	46540376	missense	possibly damaging	0.72
IGL03008:Cul9	APN	17	46502697	splice site	probably benign
IGL03059:Cul9	APN	17	46538987	missense	probably damaging	0.98
IGL03302:Cul9	APN	17	46526640	missense	probably damaging	0.98
bottlenose	UTSW	17	46500844	missense	possibly damaging	0.79
flipper	UTSW	17	46525892	missense	probably benign	0.05
orca	UTSW	17	46525135	missense	probably damaging	1.00
FR4340:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4449:Cul9	UTSW	17	46500856	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500846	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500858	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500848	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500850	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500856	small insertion	probably benign
R0012:Cul9	UTSW	17	46538510	missense	probably benign	0.26
R0079:Cul9	UTSW	17	46537663	nonsense	probably null
R0143:Cul9	UTSW	17	46526410	missense	possibly damaging	0.65
R0390:Cul9	UTSW	17	46528589	missense	probably benign	0.34
R0401:Cul9	UTSW	17	46541704	missense	probably damaging	1.00
R0529:Cul9	UTSW	17	46520468	splice site	probably benign
R0815:Cul9	UTSW	17	46537822	splice site	probably null
R0863:Cul9	UTSW	17	46537822	splice site	probably null
R0972:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1173:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1216:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1217:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1261:Cul9	UTSW	17	46525782	missense	probably damaging	1.00
R1278:Cul9	UTSW	17	46500849	small deletion	probably benign
R1281:Cul9	UTSW	17	46511534	missense	probably damaging	1.00
R1349:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1372:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1482:Cul9	UTSW	17	46508547	missense	probably damaging	0.99
R1491:Cul9	UTSW	17	46538564	nonsense	probably null
R1618:Cul9	UTSW	17	46525892	missense	probably benign	0.05
R1641:Cul9	UTSW	17	46543560	missense	possibly damaging	0.96
R1679:Cul9	UTSW	17	46521156	missense	possibly damaging	0.90
R1771:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R1803:Cul9	UTSW	17	46503097	missense	probably damaging	1.00
R2020:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R2046:Cul9	UTSW	17	46543733	missense	probably damaging	1.00
R2056:Cul9	UTSW	17	46543372	missense	probably benign
R2088:Cul9	UTSW	17	46526649	missense	probably damaging	1.00
R2415:Cul9	UTSW	17	46543438	missense	probably benign
R2925:Cul9	UTSW	17	46510981	missense	probably benign	0.08
R2964:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R2965:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R3690:Cul9	UTSW	17	46504031	splice site	probably null
R4437:Cul9	UTSW	17	46502159	missense	probably damaging	1.00
R4470:Cul9	UTSW	17	46538336	missense	probably benign	0.00
R4540:Cul9	UTSW	17	46503089	missense	probably null	0.98
R4555:Cul9	UTSW	17	46501829	missense	possibly damaging	0.82
R4604:Cul9	UTSW	17	46530146	missense	probably damaging	0.99
R4646:Cul9	UTSW	17	46539017	nonsense	probably null
R4799:Cul9	UTSW	17	46500844	missense	possibly damaging	0.79
R4822:Cul9	UTSW	17	46530051	missense	probably benign	0.01
R4964:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R4965:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R5027:Cul9	UTSW	17	46500782	missense	probably damaging	0.99
R5185:Cul9	UTSW	17	46525832	missense	possibly damaging	0.95
R5237:Cul9	UTSW	17	46543467	missense	probably benign	0.00
R5278:Cul9	UTSW	17	46510873	missense	probably damaging	1.00
R5361:Cul9	UTSW	17	46500849	small deletion	probably benign
R5455:Cul9	UTSW	17	46510846	splice site	probably null
R5592:Cul9	UTSW	17	46520591	missense	probably benign	0.00
R5597:Cul9	UTSW	17	46502665	missense	possibly damaging	0.56
R5613:Cul9	UTSW	17	46503844	missense	probably damaging	1.00
R6122:Cul9	UTSW	17	46521928	missense	possibly damaging	0.72
R6135:Cul9	UTSW	17	46521453	missense	probably benign
R6352:Cul9	UTSW	17	46511315	missense	probably benign	0.00
R6376:Cul9	UTSW	17	46508563	missense	probably damaging	1.00
R6868:Cul9	UTSW	17	46522183	missense	possibly damaging	0.73
R6898:Cul9	UTSW	17	46511026	missense	possibly damaging	0.87
R7090:Cul9	UTSW	17	46500839	missense	probably damaging	0.96
R7193:Cul9	UTSW	17	46538497	missense	probably damaging	0.98
R7221:Cul9	UTSW	17	46528565	missense	probably damaging	0.99
R7291:Cul9	UTSW	17	46540433	missense	probably benign	0.00
R7320:Cul9	UTSW	17	46510909	missense	possibly damaging	0.80
R7348:Cul9	UTSW	17	46510993	missense	possibly damaging	0.89
R7463:Cul9	UTSW	17	46520476	splice site	probably null
R7480:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R7573:Cul9	UTSW	17	46519910	missense	probably benign
R7582:Cul9	UTSW	17	46510979	missense	probably damaging	1.00
R7605:Cul9	UTSW	17	46541732	missense	probably damaging	0.99
R7684:Cul9	UTSW	17	46509889	missense	probably damaging	1.00
R7830:Cul9	UTSW	17	46540311	missense	probably benign	0.37
R7834:Cul9	UTSW	17	46525704	splice site	probably null
R8131:Cul9	UTSW	17	46511242	missense	probably damaging	1.00
R8192:Cul9	UTSW	17	46538347	missense	probably benign	0.01
R8231:Cul9	UTSW	17	46520501	missense	probably damaging	0.99
R8248:Cul9	UTSW	17	46530014	missense	probably damaging	0.99
R8504:Cul9	UTSW	17	46503580	missense	probably damaging	1.00
R8550:Cul9	UTSW	17	46519846	missense	probably damaging	1.00
R8716:Cul9	UTSW	17	46527914	missense	probably benign	0.28
R8769:Cul9	UTSW	17	46521902	missense	possibly damaging	0.85
R8893:Cul9	UTSW	17	46500849	small deletion	probably benign
R8904:Cul9	UTSW	17	46520501	missense	probably damaging	0.99
R8936:Cul9	UTSW	17	46528602	missense	possibly damaging	0.82
R8972:Cul9	UTSW	17	46543251	missense	probably damaging	1.00
R9003:Cul9	UTSW	17	46525075	missense	possibly damaging	0.78
R9012:Cul9	UTSW	17	46543521	missense	probably benign
R9056:Cul9	UTSW	17	46543770	missense	probably damaging	0.99
R9071:Cul9	UTSW	17	46526453	missense	probably benign
R9162:Cul9	UTSW	17	46526603	missense	probably benign	0.32
R9476:Cul9	UTSW	17	46510907	missense	probably damaging	1.00
R9526:Cul9	UTSW	17	46530100	missense	probably benign	0.41
R9563:Cul9	UTSW	17	46509971	missense	not run
R9568:Cul9	UTSW	17	46520118	missense	not run
RF011:Cul9	UTSW	17	46500848	small insertion	probably benign
RF016:Cul9	UTSW	17	46500863	nonsense	probably null
RF026:Cul9	UTSW	17	46500869	nonsense	probably null
RF027:Cul9	UTSW	17	46500848	small insertion	probably benign
RF030:Cul9	UTSW	17	46500869	small insertion	probably benign
RF033:Cul9	UTSW	17	46500854	small insertion	probably benign
RF039:Cul9	UTSW	17	46500854	small insertion	probably benign
RF041:Cul9	UTSW	17	46500854	nonsense	probably null
RF042:Cul9	UTSW	17	46540615	frame shift	probably null
RF057:Cul9	UTSW	17	46500863	nonsense	probably null
Z1176:Cul9	UTSW	17	46520576	nonsense	probably null
Z1176:Cul9	UTSW	17	46520585	nonsense	probably null
Z1177:Cul9	UTSW	17	46537797	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TTTACAAAGAGCATTGTGGGAC -3'
(R):5'- ATCTCTGCCAGGGTTAGTACC -3'

Sequencing Primer
(F):5'- CGGTGCTTTGCGGGAGATAAC -3'
(R):5'- GGTTAGTACCCTCAGCCATG -3'

Posted On

2015-04-06