Incidental Mutation 'R3847:Cul9'
ID277460
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46525135 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1195 (Y1195C)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably damaging
Transcript: ENSMUST00000066026
AA Change: Y1195C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: Y1195C

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182451
Predicted Effect probably damaging
Transcript: ENSMUST00000182485
AA Change: Y1195C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: Y1195C

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183163
Meta Mutation Damage Score 0.6024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1618:Cul9 UTSW 17 46525892 missense probably benign 0.05
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6122:Cul9 UTSW 17 46521928 missense possibly damaging 0.72
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7463:Cul9 UTSW 17 46520476 splice site probably null
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7582:Cul9 UTSW 17 46510979 missense probably damaging 1.00
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7684:Cul9 UTSW 17 46509889 missense probably damaging 1.00
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
R7917:Cul9 UTSW 17 46525704 splice site probably null
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTACAAAGAGCATTGTGGGAC -3'
(R):5'- ATCTCTGCCAGGGTTAGTACC -3'

Sequencing Primer
(F):5'- CGGTGCTTTGCGGGAGATAAC -3'
(R):5'- GGTTAGTACCCTCAGCCATG -3'
Posted On2015-04-06