Incidental Mutation 'R3847:Mpnd'
ID277462
Institutional Source Beutler Lab
Gene Symbol Mpnd
Ensembl Gene ENSMUSG00000003199
Gene NameMPN domain containing
Synonyms
MMRRC Submission 040895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R3847 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56005711-56016790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56011692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 150 (S150P)
Ref Sequence ENSEMBL: ENSMUSP00000122480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133998] [ENSMUST00000149441] [ENSMUST00000159996] [ENSMUST00000162883]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131218
Predicted Effect probably damaging
Transcript: ENSMUST00000133998
AA Change: S150P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122480
Gene: ENSMUSG00000003199
AA Change: S150P

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140926
Predicted Effect probably benign
Transcript: ENSMUST00000149441
AA Change: S234P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119745
Gene: ENSMUSG00000003199
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153197
AA Change: S91P
SMART Domains Protein: ENSMUSP00000125535
Gene: ENSMUSG00000003199
AA Change: S91P

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Pfam:JAB 112 243 6.1e-11 PFAM
Pfam:Prok-JAB 125 258 1.2e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159340
AA Change: S230P
SMART Domains Protein: ENSMUSP00000125555
Gene: ENSMUSG00000003199
AA Change: S230P

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 29 68 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
Blast:JAB_MPN 257 350 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159420
Predicted Effect probably benign
Transcript: ENSMUST00000159996
AA Change: S234P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124644
Gene: ENSMUSG00000003199
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162883
AA Change: S234P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124128
Gene: ENSMUSG00000003199
AA Change: S234P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
Pfam:Prok-JAB 230 340 1.6e-8 PFAM
Pfam:JAB 236 311 1.7e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,736,324 probably null Het
Abcc12 C T 8: 86,553,391 E338K probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Ankrd16 G A 2: 11,789,808 E335K probably benign Het
Atm A G 9: 53,503,075 F905S possibly damaging Het
Bckdha C T 7: 25,631,652 R281H probably damaging Het
Blvra C T 2: 127,095,191 T188I probably damaging Het
Bmp8b C A 4: 123,116,168 probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cacng8 T C 7: 3,394,474 S84P probably damaging Het
Cad T A 5: 31,061,650 V605E probably damaging Het
Ccny A G 18: 9,449,641 S11P probably benign Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Corin T C 5: 72,422,165 E155G probably benign Het
Cul9 T C 17: 46,525,135 Y1195C probably damaging Het
Cyp27a1 A G 1: 74,737,559 E501G probably damaging Het
Dennd3 T A 15: 73,542,732 N457K possibly damaging Het
Dnah7a T G 1: 53,501,656 I2520L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fgf14 A C 14: 123,980,389 I234R probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gad2 T G 2: 22,684,988 D472E probably benign Het
Garnl3 G T 2: 32,992,228 H832N probably benign Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Gnptab T A 10: 88,433,577 L714* probably null Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Guf1 A G 5: 69,561,157 N213S probably damaging Het
H2-K1 T G 17: 33,997,329 H281P probably damaging Het
Hhip T A 8: 79,997,495 M373L probably benign Het
Ifi203 C T 1: 173,933,796 C229Y possibly damaging Het
Ighv13-2 A G 12: 114,357,798 L88S probably damaging Het
Kcna3 T C 3: 107,036,696 Y92H possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mknk2 C T 10: 80,667,975 W367* probably null Het
Mocos A G 18: 24,676,662 K441E probably damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Neurod4 C T 10: 130,270,482 V308I probably benign Het
Nxf3 C T X: 136,073,983 V474I probably benign Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr976 A T 9: 39,956,581 M118K probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Pde5a T C 3: 122,803,160 Y467H probably damaging Het
Pibf1 T A 14: 99,137,121 V332E possibly damaging Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sept11 G T 5: 93,162,167 M276I probably damaging Het
Slc30a4 A G 2: 122,702,272 V50A probably damaging Het
Sorbs1 A G 19: 40,314,443 V570A probably damaging Het
Spout1 T C 2: 30,177,407 probably null Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thsd1 A G 8: 22,259,411 H713R probably damaging Het
Ttc21b A G 2: 66,242,679 L221S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Wnk1 C T 6: 119,969,354 G613S possibly damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp335 C A 2: 164,900,106 probably null Het
Zmym2 T A 14: 56,921,499 probably benign Het
Other mutations in Mpnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1673:Mpnd UTSW 17 56010455 missense probably damaging 0.98
R1939:Mpnd UTSW 17 56015920 missense probably damaging 1.00
R2182:Mpnd UTSW 17 56015964 missense probably benign 0.16
R3849:Mpnd UTSW 17 56011692 missense probably damaging 1.00
R4888:Mpnd UTSW 17 56011641 missense probably benign
R4931:Mpnd UTSW 17 56012362 intron probably benign
R4947:Mpnd UTSW 17 56010268 splice site probably benign
R6191:Mpnd UTSW 17 56012482 missense possibly damaging 0.90
R6478:Mpnd UTSW 17 56009575 missense probably damaging 1.00
R7086:Mpnd UTSW 17 56009457 missense possibly damaging 0.73
R7544:Mpnd UTSW 17 56011666 missense probably benign 0.03
R7654:Mpnd UTSW 17 56010489 missense probably benign 0.02
R7887:Mpnd UTSW 17 56011097 missense probably benign 0.03
R7970:Mpnd UTSW 17 56011097 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGGGAATCCTGAATCCTG -3'
(R):5'- CTTGTTGATGGCAGCAAAGG -3'

Sequencing Primer
(F):5'- TCACAGAGATGCATCCTCTGAGTG -3'
(R):5'- GGCAGCAAAGGATGTTACTTCTACC -3'
Posted On2015-04-06