Incidental Mutation 'R1988:Dopey2'
ID277484
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1988 (G1)
Quality Score51
Status Validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93766173 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 855 (I855N)
Ref Sequence ENSEMBL: ENSMUSP00000154771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
Predicted Effect probably damaging
Transcript: ENSMUST00000045004
AA Change: I973N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: I973N

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226215
AA Change: I183N
Predicted Effect unknown
Transcript: ENSMUST00000226836
AA Change: I135N
Predicted Effect probably damaging
Transcript: ENSMUST00000227156
AA Change: I855N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7922:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7945:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7977:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R8033:Dopey2 UTSW 16 93769483 missense not run
R8061:Dopey2 UTSW 16 93749996 missense not run
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense not run
Z1176:Dopey2 UTSW 16 93803546 missense not run
Z1176:Dopey2 UTSW 16 93807868 missense not run
Z1177:Dopey2 UTSW 16 93763895 missense not run
Predicted Primers PCR Primer
(F):5'- TAAGGCCAGTATGATGAAGCTC -3'
(R):5'- AAGGCACAGTCACTCGTGTG -3'

Sequencing Primer
(F):5'- CAGTATGATGAAGCTCCCTGG -3'
(R):5'- TGAGCACCCACAGCAGTG -3'
Posted On2015-04-13