Mutagenetix > Incidental Mutations

Incidental Mutation 'R1936:Plxnb1'

277486

Institutional Source

Beutler Lab

Gene Symbol

Plxnb1

Ensembl Gene

ENSMUSG00000053646

Gene Name

plexin B1

Synonyms

2900002G15Rik

MMRRC Submission

039954-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1936 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

109095389-109119917 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 109095647 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000071966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026735] [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]

Predicted Effect

probably benign
Transcript: ENSMUST00000026735

SMART Domains

Protein: ENSMUSP00000026735
Gene: ENSMUSG00000025645

Domain	Start	End	E-Value	Type
coiled coil region	109	162	N/A	INTRINSIC
low complexity region	224	236	N/A	INTRINSIC
low complexity region	274	286	N/A	INTRINSIC
transmembrane domain	381	403	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000072093

SMART Domains

Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	35	463	5.84e-101	SMART
PSI	481	534	1.17e-13	SMART
PSI	628	678	6.97e-3	SMART
low complexity region	691	706	N/A	INTRINSIC
low complexity region	752	771	N/A	INTRINSIC
PSI	1019	1066	2.06e-5	SMART
IPT	1067	1158	7.48e-18	SMART
IPT	1159	1247	3.97e-22	SMART
IPT	1249	1359	6.09e-9	SMART
low complexity region	1483	1494	N/A	INTRINSIC
Pfam:Plexin_cytopl	1546	2086	6.5e-230	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130366

SMART Domains

Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sema	35	138	7.5e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131462

SMART Domains

Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sema	35	138	7.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134690

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.5%

Validation Efficiency

99% (98/99)

MGI Phenotype

PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,917,080	Q226R	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Abca13	G	A	11: 9,293,595	M1819I	probably benign	Het
Abca4	G	A	3: 122,052,923	V30M	probably benign	Het
Ablim1	T	A	19: 57,215,965		probably null	Het
Adgrf3	A	T	5: 30,202,306	N207K	probably benign	Het
Anapc4	T	A	5: 52,839,668	D94E	probably damaging	Het
Arfgef2	A	G	2: 166,863,603	N918S	probably benign	Het
Arhgap45	A	G	10: 80,030,954	N1097S	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Cacna2d2	T	C	9: 107,509,256	F194S	probably damaging	Het
Cacna2d4	A	G	6: 119,270,761	D341G	possibly damaging	Het
Ccdc129	G	T	6: 55,897,681	L205F	probably damaging	Het
Cdc42bpg	A	G	19: 6,310,309	Y175C	probably damaging	Het
Cep170b	G	T	12: 112,735,738	D322Y	probably damaging	Het
Cflar	T	A	1: 58,752,625	Y362*	probably null	Het
Chml	A	T	1: 175,687,259	C365*	probably null	Het
Clrn3	A	C	7: 135,514,024	I199S	possibly damaging	Het
Crtam	G	C	9: 41,004,550	P13A	probably benign	Het
Defb26	T	A	2: 152,508,275	K28N	possibly damaging	Het
Dennd1c	G	A	17: 57,073,889		probably benign	Het
Dgkz	A	T	2: 91,937,978	M761K	possibly damaging	Het
Dnhd1	A	T	7: 105,673,976	M564L	probably benign	Het
Dusp15	A	G	2: 152,945,421		probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eapp	A	T	12: 54,673,728	M234K	probably benign	Het
Epha8	T	C	4: 136,940,243	D309G	probably benign	Het
Gfi1b	T	C	2: 28,610,113	K302R	possibly damaging	Het
Gimap3	A	T	6: 48,765,749	F82L	probably damaging	Het
Gm4862	T	C	3: 139,128,492		noncoding transcript	Het
Gpatch1	A	G	7: 35,295,522	S440P	probably damaging	Het
Gpr152	A	G	19: 4,142,532	D24G	probably damaging	Het
Gpr6	T	C	10: 41,071,481	E35G	probably benign	Het
Hip1r	T	A	5: 123,996,071	M270K	probably damaging	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Klf16	G	A	10: 80,576,905	A99V	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lvrn	A	T	18: 46,878,320	Y448F	probably benign	Het
Mark3	A	G	12: 111,618,365	M132V	probably damaging	Het
Mast3	A	G	8: 70,784,800	Y577H	probably damaging	Het
Med24	A	T	11: 98,718,816		probably null	Het
Mif	G	T	10: 75,859,847	H41N	possibly damaging	Het
Myo18b	T	C	5: 112,760,356	N2017S	probably benign	Het
Neurl4	C	T	11: 69,907,133	R740C	probably damaging	Het
Nlgn1	G	T	3: 26,331,790		probably benign	Het
Olfr1095	A	G	2: 86,851,401	M99T	probably benign	Het
Olfr288	T	A	15: 98,187,581	H72L	probably benign	Het
Olfr319	T	A	11: 58,702,346	L215Q	probably damaging	Het
Olfr870	A	G	9: 20,171,181	L130P	probably damaging	Het
Paip1	T	A	13: 119,457,014	M463K	probably damaging	Het
Parp3	T	A	9: 106,474,732	Y147F	probably damaging	Het
Pgrmc2	C	A	3: 41,083,038		probably benign	Het
Phldb3	G	A	7: 24,617,407	A278T	probably benign	Het
Pphln1	A	G	15: 93,488,987	D234G	possibly damaging	Het
Prdm2	T	C	4: 143,134,462	S753G	probably benign	Het
Prss32	A	G	17: 23,856,050	R125G	possibly damaging	Het
Psg22	A	T	7: 18,719,710	N149I	probably damaging	Het
Psmd11	T	C	11: 80,428,744	L20P	probably damaging	Het
Recql5	T	C	11: 115,897,191	Y434C	probably benign	Het
Rexo1	A	G	10: 80,550,469	S252P	probably benign	Het
Sdr9c7	A	G	10: 127,903,634	K206R	probably benign	Het
Slc17a8	T	C	10: 89,577,915	M484V	probably benign	Het
Slc1a2	A	G	2: 102,777,605	N530D	probably benign	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slc25a24	A	T	3: 109,136,265	E79D	probably damaging	Het
Smchd1	T	C	17: 71,463,791	Y132C	probably damaging	Het
Sorcs1	T	C	19: 50,232,644	D545G	probably damaging	Het
Sorcs2	A	G	5: 36,071,387	S104P	possibly damaging	Het
Speg	C	T	1: 75,431,408	T3249I	possibly damaging	Het
Spry4	A	G	18: 38,590,089	I207T	possibly damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Tdrd6	A	G	17: 43,626,467	L1230P	probably damaging	Het
Tesk2	A	G	4: 116,741,824	Y43C	probably benign	Het
Tex101	A	G	7: 24,668,225	V234A	probably benign	Het
Tmem161b	T	A	13: 84,293,466	L210Q	probably damaging	Het
Tmprss11f	T	A	5: 86,544,864	Q67L	probably benign	Het
Tnfrsf23	A	G	7: 143,668,554	F174L	probably benign	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Trdmt1	A	G	2: 13,511,609	L386P	probably damaging	Het
Trim25	A	T	11: 89,004,750	T206S	probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trpc4	T	A	3: 54,279,890	M421K	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttn	T	A	2: 76,747,178	D24457V	probably damaging	Het
Ttn	A	C	2: 76,885,490		probably benign	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vmn2r94	G	A	17: 18,244,292	R579*	probably null	Het
Vps72	T	A	3: 95,122,540	V290D	probably benign	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp26	A	G	9: 20,437,553	Y572H	probably benign	Het
Zfp292	A	G	4: 34,807,452	V1864A	probably benign	Het
Zfp952	A	T	17: 33,003,669	H374L	possibly damaging	Het
Zfy2	C	A	Y: 2,121,496	M132I	probably benign	Het

Other mutations in Plxnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Plxnb1	APN	9	109113868	missense	probably benign	0.04
IGL01014:Plxnb1	APN	9	109106034	missense	probably benign	0.00
IGL01142:Plxnb1	APN	9	109102697	missense	probably benign	0.05
IGL01454:Plxnb1	APN	9	109113354	missense	probably damaging	1.00
IGL01469:Plxnb1	APN	9	109105415	intron	probably benign
IGL01530:Plxnb1	APN	9	109110405	missense	probably benign	0.02
IGL01599:Plxnb1	APN	9	109110604	missense	probably damaging	1.00
IGL01968:Plxnb1	APN	9	109100984	missense	probably benign	0.00
IGL02175:Plxnb1	APN	9	109100846	missense	possibly damaging	0.85
IGL02216:Plxnb1	APN	9	109100850	missense	probably damaging	1.00
IGL02277:Plxnb1	APN	9	109112133	missense	probably damaging	1.00
IGL02311:Plxnb1	APN	9	109101122	missense	probably benign
IGL02645:Plxnb1	APN	9	109114243	splice site	probably benign
IGL03076:Plxnb1	APN	9	109106902	missense	probably damaging	0.96
IGL03107:Plxnb1	APN	9	109104986	missense	probably benign
IGL03343:Plxnb1	APN	9	109114712	missense	probably damaging	1.00
PIT4431001:Plxnb1	UTSW	9	109100718	missense	probably damaging	1.00
R0117:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.93
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0843:Plxnb1	UTSW	9	109113701	missense	probably benign	0.20
R0970:Plxnb1	UTSW	9	109103263	missense	probably damaging	1.00
R0973:Plxnb1	UTSW	9	109102142	missense	possibly damaging	0.47
R1342:Plxnb1	UTSW	9	109100652	missense	possibly damaging	0.87
R1386:Plxnb1	UTSW	9	109101023	missense	probably benign	0.27
R1419:Plxnb1	UTSW	9	109114386	missense	probably damaging	1.00
R1445:Plxnb1	UTSW	9	109108921	missense	probably null
R1548:Plxnb1	UTSW	9	109100900	missense	possibly damaging	0.95
R1621:Plxnb1	UTSW	9	109106805	missense	probably benign	0.04
R1658:Plxnb1	UTSW	9	109102871	nonsense	probably null
R1727:Plxnb1	UTSW	9	109101057	splice site	probably null
R1750:Plxnb1	UTSW	9	109111768	missense	probably benign	0.00
R1795:Plxnb1	UTSW	9	109100745	missense	probably benign
R1929:Plxnb1	UTSW	9	109102708	splice site	probably null
R1935:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R2014:Plxnb1	UTSW	9	109106619	splice site	probably benign
R2057:Plxnb1	UTSW	9	109109226	missense	possibly damaging	0.71
R2102:Plxnb1	UTSW	9	109115742	missense	probably damaging	1.00
R2271:Plxnb1	UTSW	9	109102708	splice site	probably null
R2422:Plxnb1	UTSW	9	109108438	missense	probably benign	0.02
R2881:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R3409:Plxnb1	UTSW	9	109106613	splice site	probably null
R3417:Plxnb1	UTSW	9	109100760	missense	probably damaging	0.97
R3756:Plxnb1	UTSW	9	109113458	unclassified	probably benign
R3788:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R3789:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R4042:Plxnb1	UTSW	9	109105173	missense	probably benign	0.00
R4289:Plxnb1	UTSW	9	109114352	missense	probably damaging	1.00
R4396:Plxnb1	UTSW	9	109100223	missense	possibly damaging	0.51
R4564:Plxnb1	UTSW	9	109113420	missense	probably benign	0.10
R4676:Plxnb1	UTSW	9	109110435	missense	possibly damaging	0.63
R4706:Plxnb1	UTSW	9	109112028	missense	probably damaging	1.00
R4792:Plxnb1	UTSW	9	109110648	missense	probably damaging	1.00
R4796:Plxnb1	UTSW	9	109114595	missense	probably damaging	1.00
R4835:Plxnb1	UTSW	9	109105374	missense	probably damaging	0.96
R4901:Plxnb1	UTSW	9	109104959	missense	probably benign	0.01
R4952:Plxnb1	UTSW	9	109114836	missense	probably damaging	1.00
R5005:Plxnb1	UTSW	9	109106579	missense	probably benign	0.00
R5015:Plxnb1	UTSW	9	109100430	missense	possibly damaging	0.95
R5029:Plxnb1	UTSW	9	109114655	missense	probably damaging	1.00
R5180:Plxnb1	UTSW	9	109111693	splice site	probably null
R5256:Plxnb1	UTSW	9	109114593	missense	probably damaging	1.00
R5285:Plxnb1	UTSW	9	109108459	missense	probably damaging	0.99
R5431:Plxnb1	UTSW	9	109100772	missense	probably damaging	1.00
R5444:Plxnb1	UTSW	9	109106453	missense	probably benign	0.22
R5546:Plxnb1	UTSW	9	109100750	missense	probably damaging	1.00
R5852:Plxnb1	UTSW	9	109106450	missense	probably damaging	1.00
R5892:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6020:Plxnb1	UTSW	9	109116611	missense	probably damaging	1.00
R6053:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6177:Plxnb1	UTSW	9	109102925	splice site	probably null
R6193:Plxnb1	UTSW	9	109104903	missense	probably benign
R6274:Plxnb1	UTSW	9	109112141	critical splice donor site	probably null
R6310:Plxnb1	UTSW	9	109109728	missense	probably damaging	0.96
R6404:Plxnb1	UTSW	9	109116637	missense	probably damaging	1.00
R6422:Plxnb1	UTSW	9	109108924	missense	probably damaging	1.00
R6479:Plxnb1	UTSW	9	109111665	missense	possibly damaging	0.92
R6555:Plxnb1	UTSW	9	109108405	critical splice acceptor site	probably null
R6646:Plxnb1	UTSW	9	109108827	missense	probably benign
R6648:Plxnb1	UTSW	9	109104330	missense	probably benign	0.14
R6661:Plxnb1	UTSW	9	109104299	missense	possibly damaging	0.94
R6674:Plxnb1	UTSW	9	109108146	missense	probably benign	0.00
R6734:Plxnb1	UTSW	9	109108920	nonsense	probably null
R6859:Plxnb1	UTSW	9	109106770	missense	probably damaging	1.00
R6948:Plxnb1	UTSW	9	109116634	missense	probably damaging	0.96
R7030:Plxnb1	UTSW	9	109112307	missense	probably damaging	1.00
R7038:Plxnb1	UTSW	9	109100385	missense	probably damaging	1.00
R7204:Plxnb1	UTSW	9	109100175	missense	probably damaging	1.00
R7427:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7428:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7443:Plxnb1	UTSW	9	109114607	missense	probably damaging	1.00
R7527:Plxnb1	UTSW	9	109100861	missense	probably damaging	0.99
R7645:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R7680:Plxnb1	UTSW	9	109100503	nonsense	probably null
R7866:Plxnb1	UTSW	9	109100457	missense	probably damaging	0.98
R7898:Plxnb1	UTSW	9	109114340	missense	probably damaging	1.00
R7905:Plxnb1	UTSW	9	109109232	missense	probably damaging	1.00
R8092:Plxnb1	UTSW	9	109100505	missense	probably damaging	1.00
R8150:Plxnb1	UTSW	9	109112078	missense	probably damaging	0.98
R8286:Plxnb1	UTSW	9	109106802	missense	probably damaging	1.00
R8290:Plxnb1	UTSW	9	109109619	missense	probably benign	0.00
Z1177:Plxnb1	UTSW	9	109108921	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCTGCGTTGCCATGACTACC -3'
(R):5'- TCTCCCAATCGCGTTACAGG -3'

Sequencing Primer
(F):5'- TGCAGCCCCCATTTAATGAGAGG -3'
(R):5'- GGTGCCGCCAGAGTTTG -3'

Posted On

2015-04-13