Incidental Mutation 'R0144:Cep170'
ID29610
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Namecentrosomal protein 170
Synonyms4933426L22Rik, A330004A13Rik
MMRRC Submission 038429-MU
Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R0144 (G1)
Quality Score140
Status Validated (trace)
Chromosome1
Chromosomal Location176733653-176814067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 176792595 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 46 (I46V)
Ref Sequence ENSEMBL: ENSMUSP00000141769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192961] [ENSMUST00000194263] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]
Predicted Effect probably benign
Transcript: ENSMUST00000057037
AA Change: I46V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: I46V

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192643
Predicted Effect probably benign
Transcript: ENSMUST00000192961
AA Change: I46V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142271
Gene: ENSMUSG00000057335
AA Change: I46V

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194263
AA Change: I46V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141720
Gene: ENSMUSG00000057335
AA Change: I46V

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194727
AA Change: I46V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: I46V

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195433
AA Change: I46V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335
AA Change: I46V

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195717
AA Change: I46V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: I46V

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176755399 missense probably damaging 1.00
IGL00925:Cep170 APN 1 176793524 missense probably damaging 1.00
IGL00972:Cep170 APN 1 176735696 missense probably benign 0.00
IGL01488:Cep170 APN 1 176756375 missense probably benign 0.00
IGL01916:Cep170 APN 1 176739910 splice site probably benign
IGL02212:Cep170 APN 1 176735936 missense probably damaging 0.99
IGL02269:Cep170 APN 1 176769366 missense probably benign
IGL02732:Cep170 APN 1 176736874 missense probably damaging 1.00
IGL02740:Cep170 APN 1 176793600 missense probably damaging 1.00
IGL02812:Cep170 APN 1 176742514 missense probably damaging 1.00
IGL03036:Cep170 APN 1 176769337 missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176736888 missense probably damaging 1.00
IGL03333:Cep170 APN 1 176769526 missense possibly damaging 0.64
PIT4520001:Cep170 UTSW 1 176780199 missense unknown
R0031:Cep170 UTSW 1 176756091 missense probably damaging 1.00
R0039:Cep170 UTSW 1 176782495 critical splice donor site probably null
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176758455 missense probably damaging 0.97
R0613:Cep170 UTSW 1 176774680 missense probably benign
R0755:Cep170 UTSW 1 176755753 missense probably damaging 1.00
R1132:Cep170 UTSW 1 176750037 missense probably damaging 1.00
R1367:Cep170 UTSW 1 176735724 missense probably damaging 0.99
R1399:Cep170 UTSW 1 176758403 missense probably damaging 0.98
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176782385 missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176788505 missense probably damaging 1.00
R1540:Cep170 UTSW 1 176739932 missense probably damaging 1.00
R1552:Cep170 UTSW 1 176782494 splice site probably benign
R1570:Cep170 UTSW 1 176755801 missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176755769 missense probably damaging 1.00
R1884:Cep170 UTSW 1 176774679 missense probably benign 0.12
R1945:Cep170 UTSW 1 176793534 nonsense probably null
R1954:Cep170 UTSW 1 176756384 missense probably benign
R1957:Cep170 UTSW 1 176769447 missense probably benign 0.24
R2184:Cep170 UTSW 1 176756976 missense probably benign 0.00
R2280:Cep170 UTSW 1 176774505 missense probably benign 0.17
R2426:Cep170 UTSW 1 176774635 missense probably benign
R3415:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3417:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3752:Cep170 UTSW 1 176782495 critical splice donor site probably benign
R3848:Cep170 UTSW 1 176755843 missense probably benign 0.14
R3849:Cep170 UTSW 1 176755843 missense probably benign 0.14
R4752:Cep170 UTSW 1 176756688 missense probably benign 0.00
R4910:Cep170 UTSW 1 176782263 missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176769814 missense probably benign 0.28
R5052:Cep170 UTSW 1 176793551 missense probably damaging 1.00
R5093:Cep170 UTSW 1 176769330 missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176769510 missense probably benign 0.00
R5622:Cep170 UTSW 1 176735867 missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176755387 unclassified probably null
R5942:Cep170 UTSW 1 176756419 missense probably damaging 1.00
R6083:Cep170 UTSW 1 176774625 missense probably damaging 1.00
R6091:Cep170 UTSW 1 176755831 missense probably damaging 0.98
R6190:Cep170 UTSW 1 176782409 missense probably damaging 1.00
R6253:Cep170 UTSW 1 176780394 missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176780351 missense possibly damaging 0.72
R6622:Cep170 UTSW 1 176756332 missense probably damaging 1.00
R6932:Cep170 UTSW 1 176761437 missense possibly damaging 0.90
R7030:Cep170 UTSW 1 176756485 missense probably damaging 0.99
R7163:Cep170 UTSW 1 176774465 missense probably damaging 1.00
R7352:Cep170 UTSW 1 176769857 missense probably benign 0.11
R7499:Cep170 UTSW 1 176774462 missense probably damaging 1.00
R7502:Cep170 UTSW 1 176756029 missense probably damaging 1.00
R7773:Cep170 UTSW 1 176740076 missense
R8043:Cep170 UTSW 1 176769242 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGAGGCTAAGCTTCAGTCTCATCT -3'
(R):5'- TCATCTAAGTCTTTGGGTTCCTTGTGC -3'

Sequencing Primer
(F):5'- GCTTCAGTCTCATCTTAGGGAAATC -3'
(R):5'- CCTTATTCGGAAATAATGCCAAAC -3'
Posted On2013-04-18