Incidental Mutation 'R0144:Rps12'
List |< first << previous [record 68 of 76] next >> last >|
ID29613
Institutional Source Beutler Lab
Gene Symbol Rps12
Ensembl Gene ENSMUSG00000061983
Gene Nameribosomal protein S12
Synonyms
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0144 (G1)
Quality Score28
Status Validated (trace)
Chromosome10
Chromosomal Location23785183-23787275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23786791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 51 (I51T)
Ref Sequence ENSEMBL: ENSMUSP00000151586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073926] [ENSMUST00000218107] [ENSMUST00000218221] [ENSMUST00000220070]
Predicted Effect probably benign
Transcript: ENSMUST00000073926
AA Change: I35T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073581
Gene: ENSMUSG00000061983
AA Change: I35T

DomainStartEndE-ValueType
Pfam:Ribosomal_L7Ae 16 111 2.7e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217883
Predicted Effect probably benign
Transcript: ENSMUST00000218107
AA Change: I35T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect unknown
Transcript: ENSMUST00000218142
AA Change: I4T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218185
Predicted Effect probably benign
Transcript: ENSMUST00000218221
AA Change: I51T

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219783
Predicted Effect probably benign
Transcript: ENSMUST00000220070
AA Change: I35T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220171
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S12E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal cancers compared to matched normal colonic mucosa has been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Rps12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1836:Rps12 UTSW 10 23785629 missense probably damaging 1.00
R2127:Rps12 UTSW 10 23786878 missense possibly damaging 0.75
R4782:Rps12 UTSW 10 23786790 missense possibly damaging 0.62
R7201:Rps12 UTSW 10 23785231 missense probably benign 0.01
R7723:Rps12 UTSW 10 23786854 missense probably benign 0.10
R8079:Rps12 UTSW 10 23785677 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACTATCTATCCCCACGAGCTACAG -3'
(R):5'- TGCGTTCAAGATTCGGCGTCAC -3'

Sequencing Primer
(F):5'- CATCCTAAGTGGGCTAGAGTTGATAC -3'
(R):5'- GTCACCCGTGATTCACCG -3'
Posted On2013-04-18