Incidental Mutation 'R0143:Prrt4'
ID29614
Institutional Source Beutler Lab
Gene Symbol Prrt4
Ensembl Gene ENSMUSG00000079654
Gene Nameproline-rich transmembrane protein 4
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0143 (G1)
Quality Score109
Status Validated (trace)
Chromosome6
Chromosomal Location29169232-29179584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 29170671 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 594 (G594A)
Ref Sequence ENSEMBL: ENSMUSP00000123751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159200]
Predicted Effect probably damaging
Transcript: ENSMUST00000159200
AA Change: G594A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123751
Gene: ENSMUSG00000079654
AA Change: G594A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 152 171 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 504 521 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 678 702 N/A INTRINSIC
low complexity region 784 824 N/A INTRINSIC
low complexity region 838 854 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Prrt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Prrt4 APN 6 29176456 missense probably benign 0.33
IGL01585:Prrt4 APN 6 29177690 missense probably benign 0.05
IGL03015:Prrt4 APN 6 29169997 missense probably benign 0.27
R0586:Prrt4 UTSW 6 29171184 missense probably damaging 1.00
R1052:Prrt4 UTSW 6 29169814 missense possibly damaging 0.66
R1391:Prrt4 UTSW 6 29169951 missense possibly damaging 0.90
R3907:Prrt4 UTSW 6 29177174 missense probably damaging 1.00
R4239:Prrt4 UTSW 6 29170164 missense probably damaging 0.97
R4829:Prrt4 UTSW 6 29177182 missense probably benign 0.01
R5070:Prrt4 UTSW 6 29177512 missense probably benign
R5825:Prrt4 UTSW 6 29177183 missense probably benign 0.31
R6023:Prrt4 UTSW 6 29176453 missense probably benign
R6776:Prrt4 UTSW 6 29176552 missense possibly damaging 0.95
R6860:Prrt4 UTSW 6 29170738 missense possibly damaging 0.90
R6984:Prrt4 UTSW 6 29171430 missense probably benign 0.18
R7032:Prrt4 UTSW 6 29170539 missense possibly damaging 0.93
R7033:Prrt4 UTSW 6 29171148 missense possibly damaging 0.89
R7444:Prrt4 UTSW 6 29176517 missense probably benign
R7689:Prrt4 UTSW 6 29177141 missense probably damaging 0.97
R7711:Prrt4 UTSW 6 29177456 missense probably benign 0.00
R7735:Prrt4 UTSW 6 29170036 missense possibly damaging 0.90
R7748:Prrt4 UTSW 6 29177191 missense probably damaging 1.00
R7775:Prrt4 UTSW 6 29177719 missense probably damaging 1.00
R7778:Prrt4 UTSW 6 29177719 missense probably damaging 1.00
R7850:Prrt4 UTSW 6 29176901 critical splice donor site probably null
R7880:Prrt4 UTSW 6 29170156 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTCCCGGAGACAATCGGAAG -3'
(R):5'- TTCTACGACGCCTACGGGCATC -3'

Sequencing Primer
(F):5'- AATCGGAAGAGCTTGGCCC -3'
(R):5'- GACTCTCGTCTGGCTACTG -3'
Posted On2013-04-18