Incidental Mutation 'R0350:Xpr1'
ID29633
Institutional Source Beutler Lab
Gene Symbol Xpr1
Ensembl Gene ENSMUSG00000026469
Gene Namexenotropic and polytropic retrovirus receptor 1
SynonymsRmc1, suppressor of yeast G deletion, Syg1, Rmc-1
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155275701-155417415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155330468 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 156 (F156Y)
Ref Sequence ENSEMBL: ENSMUSP00000107405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027741] [ENSMUST00000111774] [ENSMUST00000111775]
Predicted Effect probably damaging
Transcript: ENSMUST00000027741
AA Change: F156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027741
Gene: ENSMUSG00000026469
AA Change: F156Y

DomainStartEndE-ValueType
Pfam:SPX 1 174 1.4e-33 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 268 616 5.8e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111774
AA Change: F156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107404
Gene: ENSMUSG00000026469
AA Change: F156Y

DomainStartEndE-ValueType
Pfam:SPX 1 176 1.5e-38 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 617 2.4e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111775
AA Change: F156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107405
Gene: ENSMUSG00000026469
AA Change: F156Y

DomainStartEndE-ValueType
Pfam:SPX 1 176 4.5e-39 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 434 3.6e-45 PFAM
Pfam:EXS 432 552 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129271
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for the xenotropic and polytropic classes of murine leukemia viruses. The encoded protein is involved in phosphate homeostasis by mediating phosphate export from the cell. Defects in this gene have been associated with idiopathic basal ganglia calcification-6. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes and heterozygotes for a variant from some wild Mus stocks, including M. spretus, support replication of xenotropic murine leukemia viruses and mink cell focus-forming murine leukemia viruses that are not replicated in most laboratory strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Xpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Xpr1 APN 1 155290234 missense probably benign 0.00
IGL02657:Xpr1 APN 1 155290280 missense probably benign 0.05
IGL03077:Xpr1 APN 1 155281028 missense possibly damaging 0.58
R0019:Xpr1 UTSW 1 155332399 splice site probably benign
R1299:Xpr1 UTSW 1 155417203 missense probably damaging 0.99
R1855:Xpr1 UTSW 1 155283256 missense probably benign
R2008:Xpr1 UTSW 1 155281029 unclassified probably null
R2071:Xpr1 UTSW 1 155290280 missense probably benign 0.05
R4293:Xpr1 UTSW 1 155312796 missense possibly damaging 0.91
R4509:Xpr1 UTSW 1 155290161 intron probably benign
R5060:Xpr1 UTSW 1 155328684 critical splice acceptor site probably null
R5527:Xpr1 UTSW 1 155290235 missense probably benign
R5586:Xpr1 UTSW 1 155312863 missense probably benign
R5860:Xpr1 UTSW 1 155332122 intron probably benign
R7565:Xpr1 UTSW 1 155307742 missense probably benign
R7729:Xpr1 UTSW 1 155312872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCAACCTAGCTTGGTGAGG -3'
(R):5'- ATGAGAACCCATGCCCAGGGAG -3'

Sequencing Primer
(F):5'- GTAATTAGAGAGAGTCCCTCCTG -3'
(R):5'- ATGCCCAGGGAGCTGAC -3'
Posted On2013-04-24