Incidental Mutation 'R0350:Olfr1218'
ID29634
Institutional Source Beutler Lab
Gene Symbol Olfr1218
Ensembl Gene ENSMUSG00000075105
Gene Nameolfactory receptor 1218
SynonymsGA_x6K02T2Q125-50536041-50535106, MOR233-12
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89052296-89061187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89055356 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 23 (K23N)
Ref Sequence ENSEMBL: ENSMUSP00000149671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099798] [ENSMUST00000213609] [ENSMUST00000215048] [ENSMUST00000215054]
Predicted Effect probably benign
Transcript: ENSMUST00000099798
AA Change: K23N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097386
Gene: ENSMUSG00000075105
AA Change: K23N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.4e-45 PFAM
Pfam:7tm_1 39 286 2.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213609
AA Change: K23N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215048
AA Change: K23N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215054
AA Change: K23N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Olfr1218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Olfr1218 APN 2 89054569 missense probably damaging 1.00
IGL03089:Olfr1218 APN 2 89055013 missense probably benign 0.34
IGL03387:Olfr1218 APN 2 89055113 missense probably damaging 1.00
R0699:Olfr1218 UTSW 2 89055292 missense possibly damaging 0.67
R1609:Olfr1218 UTSW 2 89055344 missense probably benign
R1856:Olfr1218 UTSW 2 89054859 missense possibly damaging 0.95
R1972:Olfr1218 UTSW 2 89054547 missense probably benign 0.05
R2066:Olfr1218 UTSW 2 89054899 missense probably damaging 0.99
R2921:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R2923:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R4037:Olfr1218 UTSW 2 89054688 missense probably damaging 0.99
R4585:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R4586:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R5041:Olfr1218 UTSW 2 89054921 nonsense probably null
R5124:Olfr1218 UTSW 2 89055087 missense probably damaging 0.96
R5138:Olfr1218 UTSW 2 89054947 missense probably benign 0.00
R5415:Olfr1218 UTSW 2 89054896 missense probably benign 0.00
R5501:Olfr1218 UTSW 2 89054886 nonsense probably null
R5941:Olfr1218 UTSW 2 89054619 missense probably benign
R5991:Olfr1218 UTSW 2 89054782 missense probably benign 0.01
R6396:Olfr1218 UTSW 2 89055297 missense probably benign 0.36
R7047:Olfr1218 UTSW 2 89055146 missense probably damaging 0.98
R8038:Olfr1218 UTSW 2 89054868 missense probably damaging 1.00
R8387:Olfr1218 UTSW 2 89055302 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAATAGCCACGTAGCGGTCATAG -3'
(R):5'- CAGCCCTGGCCTTGAGTTATTCAC -3'

Sequencing Primer
(F):5'- GGCTGCTAGGACAATCATTTC -3'
(R):5'- TCAATTCAAGAGCGTTGTACCC -3'
Posted On2013-04-24