Incidental Mutation 'R0350:Nr1h3'
ID29635
Institutional Source Beutler Lab
Gene Symbol Nr1h3
Ensembl Gene ENSMUSG00000002108
Gene Namenuclear receptor subfamily 1, group H, member 3
SynonymsUnr1, LXR alpha
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0350 (G1)
Quality Score171
Status Not validated
Chromosome2
Chromosomal Location91184061-91202834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91191825 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 153 (L153F)
Ref Sequence ENSEMBL: ENSMUSP00000106988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002177] [ENSMUST00000111354] [ENSMUST00000111355] [ENSMUST00000111356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002177
AA Change: L153F

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002177
Gene: ENSMUSG00000002108
AA Change: L153F

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111354
AA Change: L153F

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106986
Gene: ENSMUSG00000002108
AA Change: L153F

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111355
AA Change: L153F

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106987
Gene: ENSMUSG00000002108
AA Change: L153F

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
HOLI 202 356 3.76e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111356
AA Change: L153F

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106988
Gene: ENSMUSG00000002108
AA Change: L153F

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150654
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility, increased suseceptibility to bacterial infection, and diet-sensitive increase in liver size, steatosis, and cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Nr1h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nr1h3 APN 2 91190199 missense probably damaging 1.00
IGL02198:Nr1h3 APN 2 91192725 missense probably damaging 1.00
IGL02992:Nr1h3 APN 2 91190566 missense probably damaging 1.00
IGL03103:Nr1h3 APN 2 91192015 missense probably damaging 1.00
R0302:Nr1h3 UTSW 2 91192013 missense probably damaging 0.98
R2397:Nr1h3 UTSW 2 91191857 missense possibly damaging 0.81
R2439:Nr1h3 UTSW 2 91190220 missense probably benign 0.45
R2988:Nr1h3 UTSW 2 91185004 missense probably damaging 0.96
R3431:Nr1h3 UTSW 2 91191860 missense probably damaging 1.00
R4842:Nr1h3 UTSW 2 91190218 missense probably benign 0.09
R5355:Nr1h3 UTSW 2 91191908 missense possibly damaging 0.67
R6137:Nr1h3 UTSW 2 91191851 missense probably damaging 1.00
R6982:Nr1h3 UTSW 2 91190759 missense probably damaging 0.98
R7380:Nr1h3 UTSW 2 91190195 missense possibly damaging 0.83
R7531:Nr1h3 UTSW 2 91184394 missense probably damaging 1.00
R7753:Nr1h3 UTSW 2 91185025 missense probably damaging 1.00
R7980:Nr1h3 UTSW 2 91190884 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTGGGTTGATGCTTCAGAAACAAA -3'
(R):5'- CCTCTGGCTTCCATTACAACGTGCT -3'

Sequencing Primer
(F):5'- gccttgaactcacagagatcc -3'
(R):5'- CATTACAACGTGCTGAGCTG -3'
Posted On2013-04-24