Incidental Mutation 'R0350:Slc35c1'
ID29636
Institutional Source Beutler Lab
Gene Symbol Slc35c1
Ensembl Gene ENSMUSG00000049922
Gene Namesolute carrier family 35, member C1
SynonymsFUCT1, E430007K15Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location92452764-92460538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92459032 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 43 (F43S)
Ref Sequence ENSEMBL: ENSMUSP00000137748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067631] [ENSMUST00000125276] [ENSMUST00000136718]
Predicted Effect probably damaging
Transcript: ENSMUST00000067631
AA Change: F56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063461
Gene: ENSMUSG00000049922
AA Change: F56S

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
Pfam:TPT 38 336 5.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125276
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119271
Gene: ENSMUSG00000049922
AA Change: F43S

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
Pfam:UAA 27 330 2e-11 PFAM
Pfam:TPT 184 325 3.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136718
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137748
Gene: ENSMUSG00000049922
AA Change: F43S

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
Pfam:UAA 27 158 4.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-fucose transporter that is found in the Golgi apparatus. Mutations in this gene result in congenital disorder of glycosylation type IIc. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit partial perinatal and postnatal lethality, growth retardation, reduced fertility, leukocytosis, defective lung and primary lymph node development and altered lymphocyte rolling and adhesion. Mortality is increased on an inbred background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Slc35c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Slc35c1 APN 2 92454358 missense probably benign 0.00
IGL00931:Slc35c1 APN 2 92458894 missense probably benign 0.00
R0458:Slc35c1 UTSW 2 92454513 missense probably damaging 0.98
R0589:Slc35c1 UTSW 2 92454514 missense probably damaging 0.98
R1878:Slc35c1 UTSW 2 92459053 missense probably benign 0.00
R1997:Slc35c1 UTSW 2 92454639 missense probably benign 0.04
R2329:Slc35c1 UTSW 2 92458695 nonsense probably null
R2473:Slc35c1 UTSW 2 92454753 missense probably benign 0.32
R2568:Slc35c1 UTSW 2 92458880 missense probably benign 0.00
R4583:Slc35c1 UTSW 2 92458921 missense probably damaging 1.00
R4761:Slc35c1 UTSW 2 92458823 missense probably damaging 0.99
R5021:Slc35c1 UTSW 2 92459021 missense possibly damaging 0.61
R7296:Slc35c1 UTSW 2 92458739 missense probably damaging 1.00
R7877:Slc35c1 UTSW 2 92459057 missense probably damaging 1.00
R8446:Slc35c1 UTSW 2 92454362 missense probably benign 0.00
R8519:Slc35c1 UTSW 2 92454707 missense probably benign 0.05
Z1176:Slc35c1 UTSW 2 92458760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGGTGGGGAAGTCTACCATGC -3'
(R):5'- ACCGATAGGTCATCCCATGTGACAG -3'

Sequencing Primer
(F):5'- AAGTCTACCATGCCGGGG -3'
(R):5'- GTCATCCCATGTGACAGTTGAAG -3'
Posted On2013-04-24