Incidental Mutation 'R0350:Exd1'
ID29638
Institutional Source Beutler Lab
Gene Symbol Exd1
Ensembl Gene ENSMUSG00000048647
Gene Nameexonuclease 3'-5' domain containing 1
SynonymsExdl1, 4932702D22Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0350 (G1)
Quality Score205
Status Not validated
Chromosome2
Chromosomal Location119516505-119547627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119523566 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 337 (N337S)
Ref Sequence ENSEMBL: ENSMUSP00000126713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060009] [ENSMUST00000171024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060009
AA Change: N337S

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054980
Gene: ENSMUSG00000048647
AA Change: N337S

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171024
AA Change: N337S

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126713
Gene: ENSMUSG00000048647
AA Change: N337S

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are fertile and viable, but exhibit defective biogenesis of antisense piRNAs and activation of transposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Exd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Exd1 APN 2 119530079 splice site probably benign
IGL02032:Exd1 APN 2 119533467 missense probably damaging 1.00
IGL02040:Exd1 APN 2 119540065 missense possibly damaging 0.79
IGL02831:Exd1 APN 2 119528754 missense probably damaging 1.00
IGL03008:Exd1 APN 2 119520381 missense probably benign 0.01
R1423:Exd1 UTSW 2 119540013 splice site probably benign
R1466:Exd1 UTSW 2 119520734 splice site probably benign
R1524:Exd1 UTSW 2 119524674 missense probably damaging 0.98
R2011:Exd1 UTSW 2 119528663 intron probably benign
R2026:Exd1 UTSW 2 119520305 missense probably benign
R4711:Exd1 UTSW 2 119538751 missense possibly damaging 0.91
R4827:Exd1 UTSW 2 119520326 missense probably benign
R4828:Exd1 UTSW 2 119520326 missense probably benign
R4829:Exd1 UTSW 2 119520326 missense probably benign
R4830:Exd1 UTSW 2 119520326 missense probably benign
R5799:Exd1 UTSW 2 119538781 missense probably benign 0.01
R6570:Exd1 UTSW 2 119520173 missense probably benign
R6654:Exd1 UTSW 2 119524717 critical splice acceptor site probably null
R6907:Exd1 UTSW 2 119533476 missense probably damaging 1.00
R7325:Exd1 UTSW 2 119520139 missense probably benign 0.28
R7684:Exd1 UTSW 2 119520203 missense probably damaging 1.00
R7921:Exd1 UTSW 2 119530099 missense probably damaging 0.99
R8029:Exd1 UTSW 2 119528723 missense probably damaging 1.00
R8428:Exd1 UTSW 2 119538867 missense possibly damaging 0.80
R8516:Exd1 UTSW 2 119520073 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGCTCTAGAACTGCAAACACAC -3'
(R):5'- CACTGCTCAGAAGGCCACAGATATG -3'

Sequencing Primer
(F):5'- ACAACCACACAGGCGAG -3'
(R):5'- acataccacctcctctgcc -3'
Posted On2013-04-24