Incidental Mutation 'R0350:Nmd3'
ID29640
Institutional Source Beutler Lab
Gene Symbol Nmd3
Ensembl Gene ENSMUSG00000027787
Gene NameNMD3 ribosome export adaptor
SynonymsC87860
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0350 (G1)
Quality Score196
Status Not validated
Chromosome3
Chromosomal Location69721985-69756373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69743574 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 359 (Y359C)
Ref Sequence ENSEMBL: ENSMUSP00000029358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029358]
Predicted Effect probably damaging
Transcript: ENSMUST00000029358
AA Change: Y359C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029358
Gene: ENSMUSG00000027787
AA Change: Y359C

DomainStartEndE-ValueType
Pfam:NMD3 17 246 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194168
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Nmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Nmd3 APN 3 69745240 missense possibly damaging 0.63
IGL01014:Nmd3 APN 3 69726386 missense probably benign 0.00
IGL01289:Nmd3 APN 3 69724287 missense possibly damaging 0.85
IGL02566:Nmd3 APN 3 69739914 unclassified probably benign
IGL03259:Nmd3 APN 3 69745243 missense possibly damaging 0.49
IGL03299:Nmd3 APN 3 69730429 splice site probably null
IGL03382:Nmd3 APN 3 69735088 missense probably damaging 0.99
R0017:Nmd3 UTSW 3 69736092 splice site probably null
R0025:Nmd3 UTSW 3 69748321 missense probably damaging 1.00
R1136:Nmd3 UTSW 3 69746716 splice site probably benign
R1635:Nmd3 UTSW 3 69739984 missense probably benign 0.03
R3081:Nmd3 UTSW 3 69724399 splice site probably benign
R3686:Nmd3 UTSW 3 69746762 missense probably damaging 1.00
R3758:Nmd3 UTSW 3 69724308 nonsense probably null
R4384:Nmd3 UTSW 3 69724398 splice site probably benign
R4774:Nmd3 UTSW 3 69745236 missense probably benign 0.11
R4778:Nmd3 UTSW 3 69731591 nonsense probably null
R4953:Nmd3 UTSW 3 69731637 missense possibly damaging 0.92
R5000:Nmd3 UTSW 3 69717402 unclassified probably benign
R5182:Nmd3 UTSW 3 69722468 critical splice donor site probably null
R6043:Nmd3 UTSW 3 69745247 missense probably benign
R6355:Nmd3 UTSW 3 69729347 missense probably benign 0.22
R6760:Nmd3 UTSW 3 69746837 critical splice donor site probably null
R7869:Nmd3 UTSW 3 69726417 missense probably damaging 1.00
R8024:Nmd3 UTSW 3 69729965 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCAGTCTGAGTTAGCCAGTCTC -3'
(R):5'- ACTGGATCAAGCATGGATCAAGCAG -3'

Sequencing Primer
(F):5'- AGTTAGCCAGTCTCTGTGAAG -3'
(R):5'- aattcaattcccagcaaccac -3'
Posted On2013-04-24