Incidental Mutation 'R0350:Cd1d1'
ID29641
Institutional Source Beutler Lab
Gene Symbol Cd1d1
Ensembl Gene ENSMUSG00000028076
Gene NameCD1d1 antigen
SynonymsCD1.1, Cd1d, Cd1a, Ly-38
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86995834-86999441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86997573 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 219 (H219Q)
Ref Sequence ENSEMBL: ENSMUSP00000029717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]
Predicted Effect probably benign
Transcript: ENSMUST00000029717
AA Change: H219Q

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: H219Q

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 1.3e-95 PFAM
IGc1 221 291 5.35e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063869
AA Change: H88Q

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076
AA Change: H88Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4MQ7|A 23 73 2e-15 PDB
IGc1 90 160 5.35e-22 SMART
low complexity region 173 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142793
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Cd1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Cd1d1 APN 3 86998173 missense probably damaging 0.99
IGL01811:Cd1d1 APN 3 86996588 missense possibly damaging 0.86
IGL02371:Cd1d1 APN 3 86998881 missense probably benign 0.40
IGL03001:Cd1d1 APN 3 86998161 missense probably benign
R1771:Cd1d1 UTSW 3 86998665 missense possibly damaging 0.85
R2407:Cd1d1 UTSW 3 86998182 missense probably damaging 1.00
R3906:Cd1d1 UTSW 3 86998756 missense probably damaging 1.00
R4540:Cd1d1 UTSW 3 86996705 missense probably benign 0.21
R4976:Cd1d1 UTSW 3 86998651 missense probably benign 0.00
R5303:Cd1d1 UTSW 3 86998120 missense probably benign 0.22
R5786:Cd1d1 UTSW 3 86998788 missense probably benign 0.17
R6088:Cd1d1 UTSW 3 86998702 missense probably benign 0.07
R6273:Cd1d1 UTSW 3 86998257 missense probably benign 0.00
R7315:Cd1d1 UTSW 3 86998113 missense possibly damaging 0.80
R7787:Cd1d1 UTSW 3 86997596 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCACATCCAGGGTTGCTTGAAG -3'
(R):5'- AGATGCTCCTGAATGACACCTGCC -3'

Sequencing Primer
(F):5'- ATCCAGGGTTGCTTGAAGATACC -3'
(R):5'- CCATGCCATATTTGAGGCAG -3'
Posted On2013-04-24