Incidental Mutation 'R0350:Csf1'
ID29644
Institutional Source Beutler Lab
Gene Symbol Csf1
Ensembl Gene ENSMUSG00000014599
Gene Namecolony stimulating factor 1 (macrophage)
Synonymscolony-stimulating factor-1, CSF-1, Csfm, M-CSF
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107741048-107760469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107748606 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 370 (M370V)
Ref Sequence ENSEMBL: ENSMUSP00000113617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000120654] [ENSMUST00000153114] [ENSMUST00000156820]
Predicted Effect probably benign
Transcript: ENSMUST00000014743
AA Change: M370V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: M370V

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118593
SMART Domains Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 1 257 9.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120243
AA Change: M370V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: M370V

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120654
SMART Domains Protein: ENSMUSP00000112832
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 31 163 1.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153114
SMART Domains Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 26 182 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155557
Predicted Effect probably benign
Transcript: ENSMUST00000156820
AA Change: M258V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119553
Gene: ENSMUSG00000014599
AA Change: M258V

DomainStartEndE-ValueType
Pfam:CSF-1 15 142 6e-37 PFAM
Pfam:CSF-1 160 279 4.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Csf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Csf1 APN 3 107756727 missense probably benign 0.00
IGL00907:Csf1 APN 3 107750346 missense probably damaging 1.00
IGL01644:Csf1 APN 3 107753842 missense possibly damaging 0.84
R0022:Csf1 UTSW 3 107753862 missense probably damaging 0.99
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0025:Csf1 UTSW 3 107748644 missense probably benign
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1531:Csf1 UTSW 3 107748338 missense possibly damaging 0.72
R1897:Csf1 UTSW 3 107748279 missense probably damaging 1.00
R4373:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4375:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4376:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4377:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4469:Csf1 UTSW 3 107750681 critical splice donor site probably null
R4474:Csf1 UTSW 3 107753856 missense probably damaging 0.98
R4604:Csf1 UTSW 3 107756962 splice site probably null
R4634:Csf1 UTSW 3 107749167 missense probably damaging 0.96
R5086:Csf1 UTSW 3 107748710 missense possibly damaging 0.72
R5156:Csf1 UTSW 3 107748936 missense probably benign 0.01
R5425:Csf1 UTSW 3 107748896 missense possibly damaging 0.96
R6120:Csf1 UTSW 3 107753854 missense probably damaging 0.96
R6268:Csf1 UTSW 3 107747157 missense possibly damaging 0.86
R6269:Csf1 UTSW 3 107749001 missense probably benign 0.04
R6273:Csf1 UTSW 3 107749163 missense probably damaging 1.00
R6298:Csf1 UTSW 3 107748359 missense possibly damaging 0.96
R7196:Csf1 UTSW 3 107753898 missense possibly damaging 0.91
R7375:Csf1 UTSW 3 107748179 missense possibly damaging 0.96
R7437:Csf1 UTSW 3 107750756 missense probably benign 0.00
R7464:Csf1 UTSW 3 107748875 missense probably benign 0.03
R7780:Csf1 UTSW 3 107750393 missense probably damaging 0.96
R7808:Csf1 UTSW 3 107760045 missense possibly damaging 0.70
R8153:Csf1 UTSW 3 107748704 missense probably damaging 0.98
Z1177:Csf1 UTSW 3 107749080 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGGCCTGTGTCAGTCAAAGGAATG -3'
(R):5'- TGGGCACTAACTGGGTCCTAGAAG -3'

Sequencing Primer
(F):5'- ACAATGCCCCAAGAGTGG -3'
(R):5'- GCTTCTGGAGAGGCTAGTGAG -3'
Posted On2013-04-24