Incidental Mutation 'R0350:Ddi2'
ID29646
Institutional Source Beutler Lab
Gene Symbol Ddi2
Ensembl Gene ENSMUSG00000078515
Gene NameDNA-damage inducible protein 2
Synonyms
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141677549-141723419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141685523 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 26 (T26M)
Ref Sequence ENSEMBL: ENSMUSP00000136018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102484] [ENSMUST00000105782] [ENSMUST00000177592]
Predicted Effect probably benign
Transcript: ENSMUST00000102484
SMART Domains Protein: ENSMUSP00000099542
Gene: ENSMUSG00000078515

DomainStartEndE-ValueType
Pfam:ubiquitin 10 79 3.1e-9 PFAM
low complexity region 177 189 N/A INTRINSIC
Pfam:Asp_protease 212 335 9.2e-65 PFAM
Pfam:RVP_2 219 348 3.7e-8 PFAM
Pfam:RVP 236 335 3.5e-8 PFAM
Pfam:Asp_protease_2 238 326 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105782
AA Change: T26M

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101408
Gene: ENSMUSG00000040715
AA Change: T26M

DomainStartEndE-ValueType
low complexity region 315 320 N/A INTRINSIC
UBA 538 575 8.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177592
AA Change: T26M

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136018
Gene: ENSMUSG00000078515
AA Change: T26M

DomainStartEndE-ValueType
low complexity region 315 320 N/A INTRINSIC
UBA 538 575 8.12e-6 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Ddi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ddi2 APN 4 141695398 splice site probably benign
IGL02012:Ddi2 APN 4 141708218 critical splice donor site probably null
IGL02281:Ddi2 APN 4 141692419 missense probably benign 0.18
IGL02395:Ddi2 APN 4 141695414 missense possibly damaging 0.86
IGL03103:Ddi2 APN 4 141703168 missense probably damaging 1.00
IGL03220:Ddi2 APN 4 141708456 missense probably benign
R0467:Ddi2 UTSW 4 141685184 missense probably benign 0.02
R0577:Ddi2 UTSW 4 141684507 missense possibly damaging 0.50
R1706:Ddi2 UTSW 4 141683997 missense probably benign 0.00
R1801:Ddi2 UTSW 4 141683972 missense probably damaging 0.96
R1839:Ddi2 UTSW 4 141713526 missense probably benign 0.08
R1878:Ddi2 UTSW 4 141684149 missense probably benign 0.08
R2113:Ddi2 UTSW 4 141703280 splice site probably null
R3906:Ddi2 UTSW 4 141684281 missense probably benign 0.05
R3907:Ddi2 UTSW 4 141684281 missense probably benign 0.05
R3908:Ddi2 UTSW 4 141684281 missense probably benign 0.05
R4911:Ddi2 UTSW 4 141684402 missense probably benign 0.28
R5296:Ddi2 UTSW 4 141684765 missense probably benign 0.01
R5383:Ddi2 UTSW 4 141684852 missense probably damaging 1.00
R5768:Ddi2 UTSW 4 141685590 missense probably damaging 1.00
R5874:Ddi2 UTSW 4 141695469 missense probably damaging 0.97
R6359:Ddi2 UTSW 4 141684588 missense probably damaging 0.99
R6603:Ddi2 UTSW 4 141683870 missense probably damaging 1.00
R6991:Ddi2 UTSW 4 141685250 missense probably benign 0.22
R7108:Ddi2 UTSW 4 141705937 missense probably benign
R7838:Ddi2 UTSW 4 141685250 missense probably benign 0.22
T0722:Ddi2 UTSW 4 141713473 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAAAGGCATGGCTAGACTCTGCTC -3'
(R):5'- AGTGACAGATGCTACCTTGCCACC -3'

Sequencing Primer
(F):5'- ACTCTGCTCTGCTGAGGAAG -3'
(R):5'- TGCCGACTTCAGATGGGTTT -3'
Posted On2013-04-24