Incidental Mutation 'R0350:Mrps17'
ID29649
Institutional Source Beutler Lab
Gene Symbol Mrps17
Ensembl Gene ENSMUSG00000034211
Gene Namemitochondrial ribosomal protein S17
Synonyms
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129715497-129722556 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 129718145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042191] [ENSMUST00000118420] [ENSMUST00000119576] [ENSMUST00000119604] [ENSMUST00000119985] [ENSMUST00000121339] [ENSMUST00000121813] [ENSMUST00000136108] [ENSMUST00000138812] [ENSMUST00000154358]
Predicted Effect unknown
Transcript: ENSMUST00000042191
AA Change: K118R
SMART Domains Protein: ENSMUSP00000040281
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118420
AA Change: K118R
SMART Domains Protein: ENSMUSP00000112993
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119576
AA Change: K118R
SMART Domains Protein: ENSMUSP00000112779
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 83 1.1e-17 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119604
AA Change: K118R
SMART Domains Protein: ENSMUSP00000114012
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119985
AA Change: K118R
SMART Domains Protein: ENSMUSP00000112762
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121339
AA Change: K118R
SMART Domains Protein: ENSMUSP00000114125
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121813
AA Change: K118R
SMART Domains Protein: ENSMUSP00000114059
Gene: ENSMUSG00000034211
AA Change: K118R

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 1.9e-8 PFAM
low complexity region 106 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136108
SMART Domains Protein: ENSMUSP00000122093
Gene: ENSMUSG00000034211

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 84 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138812
Predicted Effect probably benign
Transcript: ENSMUST00000154358
SMART Domains Protein: ENSMUSP00000115189
Gene: ENSMUSG00000034211

DomainStartEndE-ValueType
Pfam:Ribosomal_S17 15 75 5.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199999
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S17P family. The encoded protein is moderately conserved between human mitochondrial and prokaryotic ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 1p, 3p, 6q, 14p, 18q, and Xq. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Mrps17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Mrps17 APN 5 129716765 missense probably benign 0.01
IGL01904:Mrps17 APN 5 129716801 missense probably damaging 1.00
IGL02137:Mrps17 APN 5 129716783 missense probably benign 0.16
IGL02139:Mrps17 APN 5 129716796 missense probably damaging 0.97
IGL03266:Mrps17 APN 5 129716742 utr 5 prime probably benign
R2410:Mrps17 UTSW 5 129717983 missense probably damaging 1.00
R7329:Mrps17 UTSW 5 129716641 intron probably benign
R7337:Mrps17 UTSW 5 129716799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCAAAACCGTGGAGTAGAAAC -3'
(R):5'- TGCCGCATCCTTAGGCATACAGAG -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtgtgtTCTTTTTG -3'
(R):5'- GCATCCTTAGGCATACAGAGTAATC -3'
Posted On2013-04-24