Incidental Mutation 'R0350:Prss37'
ID29650
Institutional Source Beutler Lab
Gene Symbol Prss37
Ensembl Gene ENSMUSG00000029909
Gene Nameprotease, serine 37
Synonyms1700016G05Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0350 (G1)
Quality Score204
Status Not validated
Chromosome6
Chromosomal Location40514824-40519508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40514959 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 229 (E229G)
Ref Sequence ENSEMBL: ENSMUSP00000031967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031967]
Predicted Effect probably damaging
Transcript: ENSMUST00000031967
AA Change: E229G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031967
Gene: ENSMUSG00000029909
AA Change: E229G

DomainStartEndE-ValueType
Tryp_SPc 15 228 2.31e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148195
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona binding and migration from the uterus into the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Prss37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Prss37 APN 6 40515383 missense possibly damaging 0.81
IGL03110:Prss37 APN 6 40519050 missense probably benign 0.00
R0201:Prss37 UTSW 6 40516349 missense probably damaging 1.00
R2118:Prss37 UTSW 6 40515360 nonsense probably null
R2120:Prss37 UTSW 6 40515360 nonsense probably null
R2124:Prss37 UTSW 6 40515360 nonsense probably null
R2504:Prss37 UTSW 6 40517826 splice site probably null
R4711:Prss37 UTSW 6 40515447 missense probably benign 0.21
R4938:Prss37 UTSW 6 40514983 missense possibly damaging 0.81
R4983:Prss37 UTSW 6 40516136 missense probably benign 0.01
R6652:Prss37 UTSW 6 40519156 start gained probably benign
R8111:Prss37 UTSW 6 40517813 missense probably benign 0.00
R8425:Prss37 UTSW 6 40516118 nonsense probably null
X0063:Prss37 UTSW 6 40516215 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAGATATAGGCTCCCAGGGTGCTG -3'
(R):5'- AAGCTCCCGTGATGACGGACAAAG -3'

Sequencing Primer
(F):5'- AGGGTGCTGCATTCCAAAC -3'
(R):5'- GCCACAGAAACTCCTTATGTGTC -3'
Posted On2013-04-24