Incidental Mutation 'R0350:Itgal'
ID29652
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Nameintegrin alpha L
SynonymsLFA-1, Ly-21, Cd11a, Ly-15
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127296260-127335138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127322081 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 770 (D770E)
Ref Sequence ENSEMBL: ENSMUSP00000131847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
Predicted Effect probably damaging
Transcript: ENSMUST00000106306
AA Change: D771E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: D771E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117762
AA Change: D770E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: D770E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118405
AA Change: D374E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830
AA Change: D374E

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120857
AA Change: D770E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: D770E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170971
AA Change: D770E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: D770E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 127302011 missense probably damaging 0.99
IGL01300:Itgal APN 7 127314118 missense probably damaging 1.00
IGL01345:Itgal APN 7 127300956 missense possibly damaging 0.56
IGL01826:Itgal APN 7 127302146 missense probably benign 0.16
IGL02202:Itgal APN 7 127330179 nonsense probably null
IGL02212:Itgal APN 7 127300980 missense probably benign 0.00
IGL02513:Itgal APN 7 127328672 missense possibly damaging 0.78
IGL02608:Itgal APN 7 127310244 missense probably damaging 1.00
IGL02946:Itgal APN 7 127314368 missense probably damaging 0.99
sunglow UTSW 7 127328747 missense probably null 0.89
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0107:Itgal UTSW 7 127328559 splice site probably benign
R0331:Itgal UTSW 7 127306681 splice site probably null
R0380:Itgal UTSW 7 127310751 nonsense probably null
R0537:Itgal UTSW 7 127311273 missense possibly damaging 0.61
R0546:Itgal UTSW 7 127310314 missense probably benign 0.00
R0594:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1167:Itgal UTSW 7 127300939 missense probably damaging 1.00
R1377:Itgal UTSW 7 127321917 missense probably damaging 1.00
R1575:Itgal UTSW 7 127300888 critical splice acceptor site probably null
R1690:Itgal UTSW 7 127302117 missense possibly damaging 0.56
R1693:Itgal UTSW 7 127305281 missense probably damaging 1.00
R1702:Itgal UTSW 7 127305025 missense probably benign 0.00
R1720:Itgal UTSW 7 127306927 missense probably benign 0.00
R1774:Itgal UTSW 7 127309622 critical splice donor site probably null
R1824:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1878:Itgal UTSW 7 127310671 missense probably benign 0.44
R1951:Itgal UTSW 7 127330145 missense probably damaging 1.00
R2265:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2267:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2269:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2276:Itgal UTSW 7 127328747 missense probably null 0.89
R2570:Itgal UTSW 7 127314096 missense probably damaging 1.00
R3925:Itgal UTSW 7 127324537 splice site probably benign
R4225:Itgal UTSW 7 127305312 missense probably damaging 1.00
R4377:Itgal UTSW 7 127328281 missense probably benign 0.00
R4466:Itgal UTSW 7 127328512 missense possibly damaging 0.93
R4579:Itgal UTSW 7 127305294 missense possibly damaging 0.83
R4656:Itgal UTSW 7 127322553 missense probably damaging 1.00
R4771:Itgal UTSW 7 127328233 missense probably damaging 1.00
R5012:Itgal UTSW 7 127299630 critical splice donor site probably null
R5328:Itgal UTSW 7 127311675 critical splice donor site probably null
R5365:Itgal UTSW 7 127305350 missense probably damaging 0.98
R5579:Itgal UTSW 7 127306929 missense probably benign 0.10
R5849:Itgal UTSW 7 127317320 missense probably benign 0.27
R5955:Itgal UTSW 7 127304989 missense possibly damaging 0.82
R6254:Itgal UTSW 7 127325203 missense probably damaging 1.00
R6269:Itgal UTSW 7 127330217 missense probably null 1.00
R6520:Itgal UTSW 7 127330331 missense probably benign 0.01
R6541:Itgal UTSW 7 127311562 missense probably damaging 0.99
R7049:Itgal UTSW 7 127296401 unclassified probably benign
R7168:Itgal UTSW 7 127330213 missense probably benign
R7419:Itgal UTSW 7 127306875 missense probably benign 0.01
R7424:Itgal UTSW 7 127317365 missense probably benign 0.00
R7454:Itgal UTSW 7 127327764 missense probably benign 0.00
R7567:Itgal UTSW 7 127299788 missense probably benign 0.00
R7696:Itgal UTSW 7 127330184 missense probably damaging 1.00
R7977:Itgal UTSW 7 127328298 missense possibly damaging 0.88
R7987:Itgal UTSW 7 127328298 missense possibly damaging 0.88
R8118:Itgal UTSW 7 127311245 missense probably benign 0.08
R8297:Itgal UTSW 7 127330466 missense unknown
R8418:Itgal UTSW 7 127330282 missense probably benign 0.02
R8477:Itgal UTSW 7 127300933 missense probably damaging 1.00
R8507:Itgal UTSW 7 127329435 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCAGCCTATCCTGAGACCTTCAATC -3'
(R):5'- CTTTGTCAGAGAAGGAAGTGCCCC -3'

Sequencing Primer
(F):5'- TTCAATCCACACAGTGACTAAGGAG -3'
(R):5'- TGAAGGGCCGTTTGACAC -3'
Posted On2013-04-24